Incidental Mutations

36 incidental mutations are currently displayed, and affect 36 genes.
4 are Possibly Damaging.
14 are Probably Damaging.
14 are Probably Benign.
4 are Probably Null.
0 create premature stop codons.
0 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 36 of 36] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 258580 UTSW 2010111I01Rik 0.116 R3702 G1 225 Y 13 63015330 N55I A T missense Het probably benign 0.012 0.090 phenotype 01/23/2015
2 258562 UTSW 9530053A07Rik 0.110 R3702 G1 225 Y 7 28157778 V2184M G A missense Het probably damaging 0.999 0.647 01/23/2015
3 258578 UTSW Abca5 0.185 R3702 G1 225 Y 11 110288058 C T splice site 5 bp Het probably null 0.976 phenotype 01/23/2015
4 258567 UTSW Cacna1a 0.899 R3702 G1 225 Y 8 84617846 S1846A T G missense Het probably damaging 0.982 0.132 phenotype 01/23/2015
5 258583 UTSW Cacna1i 0.000 R3702 G1 225 Y 15 80381071 A T splice site Het probably benign 0.090 phenotype 01/23/2015
6 258587 UTSW Calhm3 0.133 R3702 G1 225 Y 19 47151748 D302V T A missense Het possibly damaging 0.875 0.127 01/23/2015
7 258576 UTSW Cluh 0.254 R3702 G1 221 Y 11 74665356 M878V A G missense Het probably benign 0.000 0.069 phenotype 01/23/2015
8 258554 UTSW Col24a1 0.000 R3702 G1 225 Y 3 145337860 H603Y C T missense Het probably benign 0.007 0.090 phenotype 01/23/2015
9 258575 UTSW Commd1 1.000 R3702 G1 225 Y 11 22974057 L277H T A missense Het probably damaging 0.998 0.647 phenotype 01/23/2015
10 258584 UTSW Cpped1 0.061 R3702 G1 225 Y 16 11828440 D135E G T missense Het probably damaging 0.998 0.751 01/23/2015
11 258569 UTSW Cul5 1.000 R3702 G1 225 Y 9 53629216 K499E T C missense Het probably damaging 0.992 0.342 phenotype 01/23/2015
12 258560 UTSW Elfn1 0.133 R3702 G1 225 Y 5 139972359 T373A A G missense Het probably benign 0.000 0.062 phenotype 01/23/2015
13 258581 UTSW Fam83h 0.434 R3702 G1 225 Y 15 76002650 R946K C T missense Het probably benign 0.000 0.073 phenotype 01/23/2015
14 258571 UTSW Gm10608 0.082 R3702 G1 150 Y 9 119160716 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA frame shift Het probably null 0.976 01/23/2015
15 258568 UTSW Grik4 0.093 R3702 G1 160 Y 9 42675218 K114E T C missense Het probably damaging 0.970 0.151 phenotype 01/23/2015
16 258579 UTSW Hivep1 0.597 R3702 G1 225 Y 13 42157727 S1148P T C missense Het probably benign 0.028 0.060 phenotype 01/23/2015
17 258589 UTSW Itgb1bp2 0.231 R3702 G1 222 Y X 101451687 T C splice site Het probably benign phenotype 01/23/2015
18 258572 UTSW Lrp1 1.000 R3702 G1 225 Y 10 127595103 R359L C A missense Het probably damaging 0.996 0.801 phenotype 01/23/2015
19 258555 UTSW Lyn 0.000 R3702 G1 225 Y 4 3742455 H28R A G missense Het probably benign 0.000 0.090 phenotype 01/23/2015
20 258564 UTSW Mtmr10 0.251 R3702 G1 225 Y 7 64337899 L729P T C missense Het probably damaging 0.998 0.167 01/23/2015
21 258585 UTSW Myot 0.000 R3702 G1 225 Y 18 44354095 T A intron Het probably null 0.976 phenotype 01/23/2015
22 341760 UTSW Obox2 0.769 R3702 G1 48 Y 7 15396957 R38L G T missense Het probably benign 0.026 0.090 09/23/2015
23 258573 UTSW Olfr787 0.069 R3702 G1 225 Y 10 129462952 Y92F A T missense Het probably damaging 0.999 0.647 phenotype 01/23/2015
24 475896 UTSW Pcdha3 0.139 R3702 G1 225 N 18 36947348 Q381R A G missense Het probably benign 0.162 phenotype 05/11/2017
25 258577 UTSW Pip4k2b 0.306 R3702 G1 225 Y 11 97729548 A G splice site Het probably benign phenotype 01/23/2015
26 258553 UTSW Ppig 0.656 R3702 G1 225 Y 2 69733209 S89T T A missense Het probably damaging 1.000 0.813 01/23/2015
27 258586 UTSW Prune2 0.000 R3702 G1 225 Y 19 17178871 D47G A G missense Het probably damaging 1.000 0.238 phenotype 01/23/2015
28 258559 UTSW Sh2b2 0.944 R3702 G1 225 Y 5 136224233 S362P A G missense Het probably damaging 0.991 0.494 phenotype 01/23/2015
29 258570 UTSW Snap91 0.946 R3702 G1 225 Y 9 86806520 T322I G A missense Het probably damaging 0.994 0.121 phenotype 01/23/2015
30 258552 UTSW Taf3 0.962 R3702 G1 225 Y 2 9952561 T112I G A missense Het possibly damaging 0.740 0.097 phenotype 01/23/2015
31 258551 UTSW Tcea1 1.000 R3702 G1 225 Y 1 4894935 V276A T C missense Het probably benign 0.059 0.146 phenotype 01/23/2015
32 258565 UTSW Tex15 0.444 R3702 G1 225 Y 8 33574166 V1208A T C missense Het probably benign 0.001 0.090 phenotype 01/23/2015
33 258561 UTSW Tomm40 1.000 R3702 G1 225 Y 7 19713673 T144K G T missense Het possibly damaging 0.893 0.128 phenotype 01/23/2015
34 258557 UTSW Zbed5 0.000 R3702 G1 225 Y 5 129903159 D650N G A missense Het possibly damaging 0.904 0.179 phenotype 01/23/2015
35 258556 UTSW Zfp326 0.229 R3702 G1 225 Y 5 105888843 A G splice site 4 bp Het probably null 0.976 01/23/2015
36 258582 UTSW Zfp647 0.123 R3702 G1 225 Y 15 76910910 R517W G A missense Het probably damaging 1.000 0.647 01/23/2015
[records 1 to 36 of 36]