Incidental Mutations

46 incidental mutations are currently displayed, and affect 46 genes.
8 are Possibly Damaging.
12 are Probably Damaging.
21 are Probably Benign.
5 are Probably Null.
1 create premature stop codons.
4 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 46 of 46] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 258690 UTSW 4932438A13Rik 1.000 R3705 G1 225 Y 3 36987581 C2703S T A missense Het probably damaging 0.997 0.612 phenotype 01/23/2015
2 258718 UTSW 9930111J21Rik1 0.072 R3705 G1 199 Y 11 48947976 T595A T C missense Het possibly damaging 0.953 0.538 01/23/2015
3 258681 UTSW Abca12 1.000 R3705 G1 225 Y 1 71285705 D1538G T C missense Het probably damaging 1.000 0.865 phenotype 01/23/2015
4 258694 UTSW Asap3 0.122 R3705 G1 217 Y 4 136241241 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGAGGAGGA small insertion Het probably benign 0.090 phenotype 01/23/2015
5 258720 UTSW Bcap29 0.128 R3705 G1 225 Y 12 31617152 H170R T C missense Het probably benign 0.003 0.090 01/23/2015
6 258730 UTSW Brwd3 0.387 R3705 G1 222 Y X 108760415 A G splice site Het probably benign 0.090 phenotype 01/23/2015
7 258727 UTSW Capn1 0.000 R3705 G1 225 Y 19 6007371 E349G T C missense Het probably damaging 1.000 0.914 phenotype 01/23/2015
8 258705 UTSW Cers3 0.244 R3705 G1 225 Y 7 66786075 A261S G T missense Het probably benign 0.253 0.105 phenotype 01/23/2015
9 258693 UTSW Csf3r 0.330 R3705 G1 225 Y 4 126032285 D221G A G missense Het possibly damaging 0.761 0.270 phenotype 01/23/2015
10 258685 UTSW Cubn 1.000 R3705 G1 225 Y 2 13350943 H1826L T A missense Het probably damaging 0.997 0.233 phenotype 01/23/2015
11 258689 UTSW Dnajc19 1.000 R3705 G1 225 Y 3 34080229 A G critical splice donor site 2 bp Het probably null 01/23/2015
12 258721 UTSW Dync1h1 1.000 R3705 G1 225 Y 12 110640586 V2566I G A missense Het possibly damaging 0.796 0.132 phenotype 01/23/2015
13 258728 UTSW Ehd1 1.000 R3705 G1 225 Y 19 6298300 D436G A G missense Het probably benign 0.044 0.269 phenotype 01/23/2015
14 258696 UTSW Fam133b 0.394 R3705 G1 225 Y 5 3561034 T C splice site Het probably benign 0.090 01/23/2015
15 258695 UTSW Fam43b 0.362 R3705 G1 132 Y 4 138395098 R304G G C missense Het probably benign 0.246 0.064 01/23/2015
16 475914 UTSW Gm13084 0.092 R3705 G1 127 N 4 143811775 T209A T C missense Het probably benign 0.060 05/11/2017
17 258702 UTSW Gpnmb 0.000 R3705 G1 225 Y 6 49051865 I439N T A missense Het possibly damaging 0.953 0.249 phenotype 01/23/2015
18 258713 UTSW Grm1 0.191 R3705 G1 225 Y 10 10782729 T339I G A missense Het possibly damaging 0.949 0.179 phenotype 01/23/2015
19 258706 UTSW Gtpbp3 0.926 R3705 G1 225 Y 8 71492135 S345A T G missense Het probably benign 0.004 0.070 phenotype 01/23/2015
20 258682 UTSW Hdac4 1.000 R3705 G1 225 Y 1 91934694 A G splice site Het probably benign phenotype 01/23/2015
21 258699 UTSW Hfm1 0.110 R3705 G1 225 Y 5 106892839 A G unclassified Het probably benign 0.090 phenotype 01/23/2015
22 258697 UTSW Ift172 1.000 R3705 G1 225 Y 5 31261437 A G critical splice donor site 2 bp Het probably null 0.950 phenotype 01/23/2015
23 258683 UTSW Igfn1 0.094 R3705 G1 225 Y 1 135968409 N1473S T C missense Het probably benign 0.000 0.090 01/23/2015
24 258707 UTSW Jak3 0.691 R3705 G1 92 Y 8 71681522 K423E A G missense Het probably damaging 0.999 0.582 phenotype 01/23/2015
25 258710 UTSW Kifc3 0.000 R3705 G1 225 Y 8 95104028 G A splice site Het probably benign 0.090 phenotype 01/23/2015
26 258698 UTSW Lrrc8d 0.000 R3705 G1 225 Y 5 105813475 S584P T C missense Het probably damaging 0.998 0.283 01/23/2015
27 258717 UTSW Nipal4 0.117 R3705 G1 225 Y 11 46161851 T C splice site Het probably benign phenotype 01/23/2015
28 258723 UTSW Nisch 0.000 R3705 G1 225 Y 14 31176745 A G unclassified Het probably benign 0.074 phenotype 01/23/2015
29 258719 UTSW Nmur2 0.096 R3705 G1 225 Y 11 56040474 Y137C T C missense Het probably damaging 1.000 0.966 phenotype 01/23/2015
30 258708 UTSW Nod2 0.180 R3705 G1 225 Y 8 88653320 S150P T C missense Het probably benign 0.017 0.090 phenotype 01/23/2015
31 258687 UTSW Olfr153 0.117 R3705 G1 225 Y 2 87532068 I12V A G missense Het probably benign 0.006 0.090 phenotype 01/23/2015
32 258691 UTSW Pdgfc 1.000 R3705 G1 225 Y 3 81204444 T C critical splice donor site 2 bp Het probably null 0.948 phenotype 01/23/2015
33 258711 UTSW Phldb1 0.133 R3705 G1 225 Y 9 44694394 H1323N G T missense Het probably damaging 0.968 0.184 01/23/2015
34 258712 UTSW Ppp1r14c 0.072 R3705 G1 225 Y 10 3423524 I112V A G missense Het possibly damaging 0.888 0.063 phenotype 01/23/2015
35 258701 UTSW Rcc1l 0.759 R3705 G1 225 Y 5 134154191 V414E A T missense Het probably damaging 0.997 0.709 phenotype 01/23/2015
36 258726 UTSW Riok3 0.397 R3705 G1 225 Y 18 12148954 M327V A G missense Het probably benign 0.073 0.073 phenotype 01/23/2015
37 258692 UTSW Sf3b4 0.954 R3705 G1 225 Y 3 96176628 T C unclassified Het probably benign 0.090 phenotype 01/23/2015
38 258686 UTSW Spag6 0.069 R3705 G1 225 Y 2 18710557 Y49C A G missense Het probably damaging 0.990 0.164 01/23/2015
39 258725 UTSW Syngap1 1.000 R3705 G1 225 Y 17 26960020 S495P T C missense Het probably damaging 1.000 0.958 phenotype 01/23/2015
40 258724 UTSW Tedc2 0.785 R3705 G1 225 Y 17 24216387 S343P A G missense Het probably benign 0.296 0.085 01/23/2015
41 258716 UTSW Tenm2 0.613 R3705 G1 209 Y 11 36068326 D1132V T A missense Het probably damaging 0.974 0.098 phenotype 01/23/2015
42 258684 UTSW Tmem63a 0.118 R3705 G1 225 Y 1 180963114 D446N G A missense Het possibly damaging 0.483 0.625 01/23/2015
43 258688 UTSW Top1 1.000 R3705 G1 225 Y 2 160702824 G A critical splice donor site 1 bp Het probably null 0.950 phenotype 01/23/2015
44 258709 UTSW Tox3 0.916 R3705 G1 225 Y 8 90248905 T366K G T missense Het possibly damaging 0.524 0.096 phenotype 01/23/2015
45 258715 UTSW Tph2 0.318 R3705 G1 225 Y 10 115119893 Q332* G A nonsense Het probably null 0.972 phenotype 01/23/2015
46 258714 UTSW Zfr2 0.069 R3705 G1 120 Y 10 81246079 V493G T G missense Het probably benign 0.401 0.090 01/23/2015
[records 1 to 46 of 46]