Incidental Mutations

71 incidental mutations are currently displayed, and affect 70 genes.
14 are Possibly Damaging.
28 are Probably Damaging.
22 are Probably Benign.
5 are Probably Null.
2 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 71 of 71] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 476142 UTSW 2310079G19Rik 0.072 R3713 G1 225 N 16 88627193 M137V T C missense Het probably benign 0.000 05/11/2017
2 259729 UTSW Aak1 0.433 R3713 G1 225 Y 6 86955190 I381N T A missense Het probably benign 0.188 0.158 phenotype 01/23/2015
3 259766 UTSW Abcd4 0.180 R3713 G1 210 Y 12 84611759 M223I C T missense Het probably benign 0.426 0.396 phenotype 01/23/2015
4 259776 UTSW Adgrf2 0.000 R3713 G1 225 Y 17 42713088 V164A A G missense Het probably damaging 0.995 0.248 phenotype 01/23/2015
5 259722 UTSW Ahdc1 0.274 R3713 G1 217 Y 4 133065986 A1513T G A missense Het possibly damaging 0.845 0.090 phenotype 01/23/2015
6 259745 UTSW Akap13 1.000 R3713 G1 225 Y 7 75586181 M168T T C missense Het probably damaging 0.976 0.112 phenotype 01/23/2015
7 259709 UTSW Aox1 0.000 R3713 G1 225 Y 1 58056215 T196I C T missense Het probably benign 0.006 0.006 phenotype 01/23/2015
8 259716 UTSW Aqr 1.000 R3713 G1 225 Y 2 114118669 A G splice site Het probably benign 0.064 phenotype 01/23/2015
9 259711 UTSW Astn1 0.235 R3713 G1 225 Y 1 158667532 E1042G A G missense Het possibly damaging 0.831 0.102 phenotype 01/23/2015
10 259752 UTSW Azi2 0.105 R3713 G1 225 Y 9 118047440 D8G A G missense Het possibly damaging 0.647 0.380 phenotype 01/23/2015
11 259738 UTSW Bcam 0.000 R3713 G1 225 Y 7 19764193 T302A T C missense Het probably benign 0.124 0.116 phenotype 01/23/2015
12 259762 UTSW Cct6b 0.361 R3713 G1 225 Y 11 82760357 I110N A T missense Het probably damaging 1.000 0.302 phenotype 01/23/2015
13 259749 UTSW Cd109 0.000 R3713 G1 217 Y 9 78712500 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT critical splice acceptor site Het probably benign 0.156 phenotype 01/23/2015
14 259736 UTSW Ceacam5 0.057 R3713 G1 225 Y 7 17759338 S762N G A missense Het possibly damaging 0.518 0.063 01/23/2015
15 259731 UTSW Cecr2 1.000 R3713 G1 225 Y 6 120758260 L819P T C missense Het probably damaging 1.000 0.230 phenotype 01/23/2015
16 259743 UTSW Cers3 0.250 R3713 G1 225 Y 7 66786075 A261S G T missense Het probably benign 0.253 0.028 phenotype 01/23/2015
17 259744 UTSW Chd2 0.690 R3713 G1 225 Y 7 73471790 A G unclassified Het probably benign phenotype 01/23/2015
18 259751 UTSW Col7a1 1.000 R3713 G1 225 Y 9 108964440 G1357* G T nonsense Het probably null 0.630 phenotype 01/23/2015
19 476138 UTSW Cux1 0.917 R3713 G1 225 N 5 136565543 A G intron Het probably benign phenotype 05/11/2017
20 259724 UTSW Cwh43 0.056 R3713 G1 89 Y 5 73438492 I535F A T missense Het probably damaging 0.992 0.162 01/23/2015
21 259773 UTSW Dexi 0.088 R3713 G1 138 Y 16 10542689 M1K A T start codon destroyed Het probably null 0.051 0.314 01/23/2015
22 259770 UTSW Dnah12 0.313 R3713 G1 225 Y 14 26812790 V2081A T C missense Het probably benign 0.000 0.122 01/23/2015
23 259761 UTSW Efcab5 0.089 R3713 G1 225 Y 11 77116182 L872Q A T missense Het probably damaging 1.000 0.174 01/23/2015
24 259763 UTSW Enpp7 0.000 R3713 G1 225 Y 11 118990518 Y163C A G missense Het probably damaging 0.999 0.208 phenotype 01/23/2015
25 259728 UTSW Fam221a 0.092 R3713 G1 225 Y 6 49372614 Y38H T C missense Het probably damaging 1.000 0.340 01/23/2015
26 259747 UTSW Foxred1 1.000 R3713 G1 137 Y 9 35210890 M1T A G start codon destroyed Het probably null 0.422 phenotype 01/23/2015
27 476139 UTSW Fscn3 0.185 R3713 G1 225 N 6 28428092 T26I C T missense Het possibly damaging 0.889 05/11/2017
28 259733 UTSW Galp 0.000 R3713 G1 225 Y 7 6213837 D72V A T missense Het probably damaging 0.976 0.200 phenotype 01/23/2015
29 259774 UTSW Gm9843 0.954 R3713 G1 225 Y 16 76403531 A G exon Het noncoding transcript 0.065 01/23/2015
30 259730 UTSW Grm7 0.000 R3713 G1 225 Y 6 110646348 V161F G T missense Het probably damaging 1.000 0.084 phenotype 01/23/2015
31 259708 UTSW Lmbrd1 1.000 R3713 G1 208 Y 1 24692995 Y98H T C missense Het probably damaging 1.000 0.254 phenotype 01/23/2015
32 259771 UTSW Lrrc63 0.091 R3713 G1 225 Y 14 75107336 Y437S T G missense Het probably benign 0.118 0.199 01/23/2015
33 259767 UTSW Macc1 0.085 R3713 G1 225 Y 12 119446841 E448G A G missense Het probably benign 0.000 0.134 phenotype 01/23/2015
34 259755 UTSW Madcam1 0.000 R3713 G1 225 Y 10 79668360 H404R A G missense Het probably benign 0.000 0.117 phenotype 01/23/2015
35 259759 UTSW Mink1 0.000 R3713 G1 225 Y 11 70608950 R773L G T missense Het possibly damaging 0.930 0.226 phenotype 01/23/2015
36 259772 UTSW Mroh2b 0.136 R3713 G1 225 Y 15 4943649 I1045V A G missense Het probably benign 0.014 0.052 01/23/2015
37 259710 UTSW Mroh3 0.056 R3713 G1 225 Y 1 136185976 T692A T C missense Het probably benign 0.009 0.117 01/23/2015
38 259758 UTSW Myo15 0.000 R3713 G1 194 Y 11 60479231 E939V A T missense Het possibly damaging 0.546 0.057 phenotype 01/23/2015
39 259769 UTSW Naip2 0.073 R3713 G1 225 Y 13 100161902 F542S A G missense Het probably damaging 1.000 0.248 phenotype 01/23/2015
40 259741 UTSW Napsa 0.132 R3713 G1 225 Y 7 44581428 Y73C A G missense Het probably damaging 1.000 0.784 phenotype 01/23/2015
41 259720 UTSW Ndst4 0.110 R3713 G1 225 Y 3 125561505 H354L A T missense Het possibly damaging 0.931 0.230 phenotype 01/23/2015
42 259748 UTSW Neil1 0.366 R3713 G1 225 Y 9 57146970 V22E A T missense Het probably damaging 0.999 0.198 phenotype 01/23/2015
43 259777 UTSW Nol4 0.607 R3713 G1 225 Y 18 23039937 I36V T C missense Het probably damaging 0.997 0.126 01/23/2015
44 259757 UTSW Nprl3 0.260 R3713 G1 225 Y 11 32255464 T111I G A missense Het probably damaging 0.983 0.176 Hbath-J mutation. [provided by MGI curators] (source: MGI)">phenotype 01/23/2015
45 259715 UTSW Olfr1184 0.067 R3713 G1 225 Y 2 88487443 T237N C A missense Het probably damaging 1.000 0.032 phenotype 01/23/2015
46 259712 UTSW Olfr361 0.103 R3713 G1 225 Y 2 37085505 M81T A G missense Het possibly damaging 0.732 0.188 phenotype 01/23/2015
47 259760 UTSW Olfr385 0.113 R3713 G1 225 Y 11 73588905 Y278N A T missense Het probably damaging 0.999 0.452 phenotype 01/23/2015
48 259754 UTSW Pald1 0.113 R3713 G1 225 Y 10 61342365 T624I G A missense Het possibly damaging 0.670 0.164 01/23/2015
49 259778 UTSW Pcdhb13 0.099 R3713 G1 225 Y 18 37443733 P388L C T missense Het probably damaging 1.000 0.734 phenotype 01/23/2015
50 476143 UTSW Pcdhga6 0.119 R3713 G1 225 N 18 37707923 V232A T C missense Het probably damaging 0.989 phenotype 05/11/2017
51 259725 UTSW Pde6b 0.000 R3713 G1 225 Y 5 108423062 I388V A G missense Het probably damaging 0.999 0.222 phenotype 01/23/2015
52 259753 UTSW Phactr2 0.000 R3713 G1 153 Y 10 13388732 C A start gained Het probably benign 0.055 01/23/2015
53 259779 UTSW Prdx5 0.327 R3713 G1 223 Y 19 6908109 D56G T C missense Het probably damaging 0.995 0.442 phenotype 01/23/2015
54 259732 UTSW Ptprh 0.000 R3713 G1 225 Y 7 4571970 I350N A T missense Het probably damaging 1.000 0.218 phenotype 01/23/2015
55 476141 UTSW Rangap1 1.000 R3713 G1 142 N 15 81710460 E389D C A missense Het probably benign 0.001 phenotype 05/11/2017
56 259723 UTSW Reln 0.951 R3713 G1 225 Y 5 21904734 V3126A A G missense Het probably damaging 0.985 0.050 phenotype 01/23/2015
57 259727 UTSW Rpl21 0.918 R3713 G1 225 Y 5 146835037 G59S G A missense Het possibly damaging 0.698 0.340 phenotype 01/23/2015
58 259737 UTSW Rsph6a 0.075 R3713 G1 172 Y 7 19057550 V215M G A missense Het probably damaging 0.978 0.032 phenotype 01/23/2015
59 259718 UTSW Smcp 0.081 R3713 G1 225 Y 3 92584124 K139E T C missense Het unknown 0.044 phenotype 01/23/2015
60 259750 UTSW Stag1 1.000 R3713 G1 225 Y 9 100889618 T699A A G missense Het probably benign 0.009 0.094 phenotype 01/23/2015
61 259742 UTSW Tarsl2 0.098 R3713 G1 225 Y 7 65688952 G A critical splice donor site 1 bp Het probably null 0.568 01/23/2015
62 259721 UTSW Tle1 0.727 R3713 G1 225 Y 4 72126422 H459Q G T missense Het possibly damaging 0.704 0.178 01/23/2015
63 259713 UTSW Ttn 1.000 R3713 G1 225 Y 2 76731019 P27302S G A missense Het probably damaging 0.961 0.112 phenotype 01/23/2015
64 259714 UTSW Ttn 1.000 R3713 G1 225 Y 2 76741266 V26428I C T missense Het probably damaging 0.972 0.150 phenotype 01/23/2015
65 259719 UTSW Usp53 0.129 R3713 G1 225 Y 3 122949319 E656G T C missense Het probably benign 0.076 0.130 phenotype 01/23/2015
66 259768 UTSW Vmn1r218 0.172 R3713 G1 225 Y 13 23136911 N63Y A T missense Het probably damaging 1.000 0.030 01/23/2015
67 259735 UTSW Vmn1r79 0.070 R3713 G1 169 Y 7 12176212 N40S A G missense Het possibly damaging 0.659 0.126 01/23/2015
68 259764 UTSW Wdr35 1.000 R3713 G1 225 Y 12 9027648 D1107G A G missense Het possibly damaging 0.680 0.104 phenotype 01/23/2015
69 259775 UTSW Zfp101 0.060 R3713 G1 225 Y 17 33381906 M292T A G missense Het probably benign 0.051 0.125 01/23/2015
70 259739 UTSW Zfp108 0.072 R3713 G1 225 Y 7 24261845 C620* T A nonsense Het probably null 0.598 01/23/2015
71 259734 UTSW Zscan4b 0.092 R3713 G1 129 Y 7 10901891 T170A T C missense Het probably benign 0.015 0.244 01/23/2015
[records 1 to 71 of 71]