Incidental Mutations

50 incidental mutations are currently displayed, and affect 49 genes.
9 are Possibly Damaging.
15 are Probably Damaging.
20 are Probably Benign.
6 are Probably Null.
1 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 50 of 50] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 271009 UTSW A630010A05Rik 0.088 R3731 G1 225 N 16 14609621 T A splice site Het probably null 03/18/2015
2 271010 UTSW Abcc5 0.000 R3731 G1 225 N 16 20398934 Y5* A T nonsense Het probably null phenotype 03/18/2015
3 270958 UTSW Acbd6 0.094 R3731 G1 203 N 1 155558725 S30T T A missense Het probably benign 0.236 0.090 03/18/2015
4 270971 UTSW Adar 1.000 R3731 G1 216 N 3 89746655 I325T T C missense Het probably damaging 0.994 phenotype 03/18/2015
5 270984 UTSW Akap13 1.000 R3731 G1 225 N 7 75611377 S92P T C missense Het probably benign 0.390 phenotype 03/18/2015
6 270959 UTSW Atp1a4 0.000 R3731 G1 225 N 1 172233961 V771E A T missense Het probably damaging 1.000 phenotype 03/18/2015
7 270997 UTSW BC030867 0.188 R3731 G1 225 N 11 102257906 E381G A G missense Het possibly damaging 0.950 03/18/2015
8 270957 UTSW Cfh 0.102 R3731 G1 225 N 1 140119970 S492P A G missense Het possibly damaging 0.708 phenotype 03/18/2015
9 270989 UTSW Crlf1 0.665 R3731 G1 225 N 8 70499442 T95A A G missense Het probably benign 0.029 phenotype 03/18/2015
10 270973 UTSW Dennd2d 0.149 R3731 G1 225 N 3 106499955 F441V T G missense Het probably damaging 1.000 03/18/2015
11 270995 UTSW Dhx33 1.000 R3731 G1 225 N 11 70989152 D344G T C missense Het probably benign 0.002 0.074 phenotype 03/18/2015
12 270976 UTSW Disp3 0.000 R3731 G1 225 N 4 148252827 S844P A G missense Het probably benign 0.031 03/18/2015
13 270994 UTSW Dock2 0.000 R3731 G1 225 N 11 34708895 K286E T C missense Het probably damaging 1.000 phenotype 03/18/2015
14 271000 UTSW Fam228a 0.059 R3731 G1 225 N 12 4718671 E203G T C missense Het probably benign 0.439 03/18/2015
15 271014 UTSW Fbxo38 0.000 R3731 G1 101 N 18 62515328 GTGCTGCTGCTGCTGCTGCTGC GTGCTGCTGCTGCTGCTGC small deletion Het probably benign 03/18/2015
16 271015 UTSW Frmpd4 0.000 R3731 G1 222 N X 167486807 T493M G A missense Het probably damaging 0.965 0.647 phenotype 03/18/2015
17 270964 UTSW Galnt13 0.180 R3731 G1 225 N 2 54933507 N365S A G missense Het possibly damaging 0.914 phenotype 03/18/2015
18 473417 UTSW Ighv1-19 0.211 R3731 G1 225 N 12 114708877 C40F C A missense Het probably damaging 1.000 04/14/2017
19 270986 UTSW Ints4 0.960 R3731 G1 225 N 7 97506101 Q320R A G missense Het probably benign 0.181 phenotype 03/18/2015
20 271013 UTSW Kctd5 0.217 R3731 G1 225 N 17 24059238 D146G T C missense Het probably benign 0.018 0.184 03/18/2015
21 270982 UTSW Loxl3 0.857 R3731 G1 225 N 6 83050671 T C critical splice donor site 2 bp Het probably null phenotype 03/18/2015
22 270966 UTSW Lrp2 1.000 R3731 G1 225 N 2 69464579 P3465L G A missense Het probably damaging 0.987 0.091 phenotype 03/18/2015
23 270967 UTSW Lrp2 1.000 R3731 G1 225 N 2 69534907 A T critical splice donor site 2 bp Het probably null phenotype 03/18/2015
24 270975 UTSW Manba 0.118 R3731 G1 225 N 3 135554850 V599I G A missense Het probably benign 0.001 0.090 phenotype 03/18/2015
25 270993 UTSW Mbd6 1.000 R3731 G1 225 N 10 127285768 A G unclassified Het probably benign 03/18/2015
26 270998 UTSW Mrc2 0.000 R3731 G1 225 N 11 105348431 G A splice site 5 bp Het probably null 0.976 phenotype 03/18/2015
27 270992 UTSW Nepn 0.000 R3731 G1 225 N 10 52404014 N401Y A T missense Het probably damaging 1.000 03/18/2015
28 271001 UTSW Nol10 0.970 R3731 G1 225 N 12 17424673 K622I A T missense Het probably benign 0.418 0.073 03/18/2015
29 271002 UTSW Npas3 0.877 R3731 G1 225 N 12 53354392 I40T T C missense Het probably benign 0.108 phenotype 03/18/2015
30 270963 UTSW Olfr348 0.053 R3731 G1 225 N 2 36786566 I14F A T missense Het possibly damaging 0.529 phenotype 03/18/2015
31 270996 UTSW Olfr389 0.051 R3731 G1 225 N 11 73776739 E196G T C missense Het probably benign 0.082 phenotype 03/18/2015
32 270988 UTSW Olfr498 0.103 R3731 G1 225 N 7 108465426 I34T T C missense Het possibly damaging 0.878 phenotype 03/18/2015
33 270987 UTSW Olfr710 0.065 R3731 G1 225 N 7 106944477 N175Y T A missense Het probably damaging 0.989 phenotype 03/18/2015
34 271006 UTSW Olfr733 0.210 R3731 G1 225 N 14 50298505 D268V T A missense Het probably damaging 1.000 phenotype 03/18/2015
35 270990 UTSW Olfr952 0.060 R3731 G1 225 N 9 39427069 M1L T A start codon destroyed Het probably benign 0.228 phenotype 03/18/2015
36 270972 UTSW Phtf1 0.000 R3731 G1 225 N 3 103985779 M120V A G missense Het probably benign 0.004 0.076 03/18/2015
37 270960 UTSW Plxna2 0.000 R3731 G1 225 N 1 194788885 Y988C A G missense Het probably benign 0.424 phenotype 03/18/2015
38 270977 UTSW Rgs12 0.320 R3731 G1 225 N 5 35032251 E658K G A missense Het probably damaging 1.000 phenotype 03/18/2015
39 270968 UTSW Ripor3 0.066 R3731 G1 225 N 2 167992819 E251Q C G missense Het probably damaging 1.000 03/18/2015
40 270974 UTSW Sec24b 0.799 R3731 G1 225 N 3 130033833 K203R T C missense Het possibly damaging 0.953 0.082 phenotype 03/18/2015
41 271004 UTSW Serpina1d 0.115 R3731 G1 225 N 12 103767905 N47Y T A missense Het possibly damaging 0.628 03/18/2015
42 270961 UTSW Setx 0.000 R3731 G1 217 N 2 29154061 GTGGCT GT frame shift Het probably null 0.976 phenotype 03/18/2015
43 270970 UTSW Sirpb1c 0.050 R3731 G1 222 N 3 15833123 K184R T C missense Het probably damaging 0.998 03/18/2015
44 270991 UTSW Slc16a10 0.116 R3731 G1 225 N 10 40056624 H314D G C missense Het possibly damaging 0.942 0.676 phenotype 03/18/2015
45 270965 UTSW Upp2 0.124 R3731 G1 225 N 2 58755367 S41P T C missense Het probably benign 0.022 03/18/2015
46 270981 UTSW Vmn1r10 0.248 R3731 G1 225 N 6 57113734 T104A A G missense Het probably damaging 0.989 03/18/2015
47 271005 UTSW Wdhd1 1.000 R3731 G1 225 N 14 47247892 S838R A C missense Het possibly damaging 0.892 phenotype 03/18/2015
48 270962 UTSW Zer1 0.155 R3731 G1 225 N 2 30110911 V166A A G missense Het probably benign 0.439 phenotype 03/18/2015
49 270969 UTSW Zfp217 0.940 R3731 G1 225 N 2 170114388 N897D T C missense Het probably benign 0.312 03/18/2015
50 271012 UTSW Zfp960 0.166 R3731 G1 225 N 17 17088371 L449H T A missense Het probably damaging 0.999 0.647 03/18/2015
[records 1 to 50 of 50]