Incidental Mutations

26 incidental mutations are currently displayed, and affect 26 genes.
4 are Possibly Damaging.
13 are Probably Damaging.
6 are Probably Benign.
2 are Probably Null.
0 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 26 of 26] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 271821 UTSW Afdn 1.000 R3764 G1 225 Y 17 13846589 A648T G A missense Het probably benign 0.074 0.090 phenotype 03/25/2015
2 271796 UTSW Cadm3 0.147 R3764 G1 225 Y 1 173346497 V50I C T missense Het probably damaging 0.999 0.647 phenotype 03/25/2015
3 271797 UTSW Cubn 1.000 R3764 G1 225 Y 2 13331585 I2477F T A missense Het possibly damaging 0.788 0.293 phenotype 03/25/2015
4 271819 UTSW Ddx41 1.000 R3764 G1 225 Y 13 55534480 R205W G A missense Het possibly damaging 0.868 0.179 phenotype 03/25/2015
5 271806 UTSW Dhx15 0.929 R3764 G1 225 Y 5 52166732 P406L G A missense Het probably benign 0.014 0.270 phenotype 03/25/2015
6 271810 UTSW Eif4e3 0.000 R3764 G1 225 Y 6 99640625 R95Q C T missense Het probably damaging 0.989 0.094 phenotype 03/25/2015
7 271813 UTSW Fam57b 0.000 R3764 G1 215 Y 7 126827513 I36T T C missense Het probably damaging 0.996 0.078 phenotype 03/25/2015
8 271801 UTSW Fmo5 0.098 R3764 G1 225 Y 3 97645717 I327T T C missense Het probably damaging 0.997 0.885 phenotype 03/25/2015
9 271805 UTSW Gckr 0.000 R3764 G1 225 Y 5 31326498 T A splice site Het probably benign 0.090 phenotype 03/25/2015
10 271809 UTSW Ghrhr 0.000 R3764 G1 225 Y 6 55380771 V129A T C missense Het probably damaging 0.980 0.252 phenotype 03/25/2015
11 473522 UTSW Gm16432 0.064 R3764 G1 225 N 1 178113132 T687S A T missense Het unknown 04/14/2017
12 271815 UTSW Gm17689 0.056 R3764 G1 225 Y 9 36581818 A T critical splice donor site 2 bp Het probably null 03/25/2015
13 271817 UTSW Gsdma 0.053 R3764 G1 225 Y 11 98670767 N191I A T missense Het probably damaging 0.978 0.107 03/25/2015
14 271804 UTSW Hadha 1.000 R3764 G1 225 Y 5 30144209 K135E T C missense Het probably damaging 0.997 0.419 phenotype 03/25/2015
15 271794 UTSW Hjurp 0.911 R3764 G1 217 Y 1 88266524 GT GTT nonsense Het probably null 0.976 03/25/2015
16 271798 UTSW Lrp2 1.000 R3764 G1 225 Y 2 69496336 E1797G T C missense Het probably damaging 1.000 0.681 phenotype 03/25/2015
17 271795 UTSW Ly9 0.000 R3764 G1 225 Y 1 171594144 Y513C T C missense Het possibly damaging 0.923 0.196 phenotype 03/25/2015
18 271802 UTSW Nphp4 0.144 R3764 G1 225 Y 4 152538017 C T splice site Het probably benign phenotype 03/25/2015
19 271814 UTSW Pcm1 0.000 R3764 G1 225 Y 8 41330882 E2005G A G missense Het probably damaging 0.999 0.070 phenotype 03/25/2015
20 271811 UTSW Spsb2 0.203 R3764 G1 152 Y 6 124809555 Y84H T C missense Het probably damaging 0.995 0.250 phenotype 03/25/2015
21 271808 UTSW Try10 0.089 R3764 G1 225 Y 6 41356524 R68C C T missense Het probably benign 0.071 0.090 phenotype 03/25/2015
22 271803 UTSW Ube3c 0.000 R3764 G1 166 Y 5 29637586 ACTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT ACTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT splice site Het probably benign 0.090 03/25/2015
23 271807 UTSW Vps50 0.850 R3764 G1 225 Y 6 3588063 I679F A T missense Het probably damaging 0.999 0.647 03/25/2015
24 271816 UTSW Wdr81 1.000 R3764 G1 225 Y 11 75452803 T546I G A missense Het probably damaging 0.998 0.647 phenotype 03/25/2015
25 271820 UTSW Zcchc6 0.712 R3764 G1 225 Y 13 59800380 E307V T A missense Het probably damaging 0.980 0.076 03/25/2015
26 271822 UTSW Zfp40 0.000 R3764 G1 225 Y 17 23177127 H94L T A missense Het possibly damaging 0.491 0.606 03/25/2015
[records 1 to 26 of 26]