Incidental Mutations

66 incidental mutations are currently displayed, and affect 66 genes.
11 are Possibly Damaging.
23 are Probably Damaging.
22 are Probably Benign.
8 are Probably Null.
3 create premature stop codons.
3 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 66 of 66] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 273267 UTSW 1600015I10Rik 0.144 R3771 G1 225 Y 6 48931196 Y377H T C missense Het probably damaging 0.999 0.200 03/25/2015
2 273309 UTSW 1810041L15Rik 0.060 R3771 G1 225 Y 15 84406685 Y120* A T nonsense Het probably null 0.631 03/25/2015
3 273298 UTSW Aanat 0.067 R3771 G1 225 Y 11 116596871 G132V G T missense Het probably damaging 1.000 0.032 phenotype 03/25/2015
4 348325 UTSW Abcb11 0.324 R3771 G1 225 Y 2 69329376 T A splice site Het probably benign 0.100 phenotype 10/07/2015
5 273275 UTSW Adam26b 0.078 R3771 G1 225 Y 8 43520714 D417V T A missense Het probably damaging 0.998 0.034 03/25/2015
6 273274 UTSW Ank1 0.537 R3771 G1 225 Y 8 23123897 S1482P T C missense Het probably benign 0.033 0.056 phenotype 03/25/2015
7 273288 UTSW Armc2 1.000 R3771 G1 225 Y 10 41922227 V768M C T missense Het probably damaging 0.998 0.030 03/25/2015
8 273289 UTSW Ascc3 0.964 R3771 G1 225 Y 10 50720718 C T splice site Het probably benign phenotype 03/25/2015
9 273318 UTSW Birc6 1.000 R3771 G1 225 Y 17 74618429 T A splice site Het probably benign 0.060 phenotype 03/25/2015
10 273282 UTSW Cd109 0.000 R3771 G1 211 Y 9 78712500 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT critical splice acceptor site Het probably benign 0.156 phenotype 03/25/2015
11 273305 UTSW Cdh12 0.129 R3771 G1 225 Y 15 21578554 A T splice site Het probably benign phenotype 03/25/2015
12 273312 UTSW Chd1 0.000 R3771 G1 225 Y 17 17374651 D16G A G missense Het probably damaging 0.998 0.546 phenotype 03/25/2015
13 273285 UTSW Clstn2 0.000 R3771 G1 225 Y 9 97582562 I180T A G missense Het probably damaging 0.996 0.158 phenotype 03/25/2015
14 273286 UTSW Cxcr6 0.000 R3771 G1 225 Y 9 123810485 I184V A G missense Het probably benign 0.021 0.124 phenotype 03/25/2015
15 273320 UTSW Dagla 0.000 R3771 G1 225 Y 19 10248467 P778S G A missense Het possibly damaging 0.888 0.224 phenotype 03/25/2015
16 273277 UTSW Ddx19b 0.000 R3771 G1 225 Y 8 111020981 K107R T C missense Het probably benign 0.026 0.182 phenotype 03/25/2015
17 273262 UTSW Dpyd 0.000 R3771 G1 225 Y 3 119412278 G A critical splice donor site 1 bp Het probably null 0.548 phenotype 03/25/2015
18 273304 UTSW Elf1 0.314 R3771 G1 225 Y 14 79567210 V105A T C missense Het possibly damaging 0.734 0.386 phenotype 03/25/2015
19 273268 UTSW Fam13a 0.000 R3771 G1 225 Y 6 58987186 K87T T G missense Het probably benign 0.106 0.116 03/25/2015
20 273253 UTSW Fap 0.000 R3771 G1 225 Y 2 62533010 S359I C A missense Het probably damaging 1.000 0.258 phenotype 03/25/2015
21 273296 UTSW Fbxo39 0.088 R3771 G1 225 Y 11 72317215 I131T T C missense Het possibly damaging 0.488 0.098 phenotype 03/25/2015
22 273256 UTSW Fmn1 0.306 R3771 G1 225 Y 2 113582118 S996A T G missense Het probably damaging 0.996 0.166 phenotype 03/25/2015
23 273265 UTSW Gm5866 0.299 R3771 G1 118 Y 5 52582746 T C exon Het noncoding transcript 0.414 03/25/2015
24 273251 UTSW Hmcn2 0.000 R3771 G1 225 Y 2 31360896 T790M C T missense Het probably damaging 0.985 0.114 03/25/2015
25 273278 UTSW Irf2bp2 0.847 R3771 G1 225 Y 8 126591811 K339E T C missense Het probably damaging 0.997 0.126 phenotype 03/25/2015
26 273302 UTSW Kat6b 0.856 R3771 G1 225 Y 14 21517098 D75G A G missense Het probably damaging 0.998 0.144 phenotype 03/25/2015
27 273295 UTSW Kcnab3 0.000 R3771 G1 225 Y 11 69328563 T127A A G missense Het probably damaging 0.966 0.204 phenotype 03/25/2015
28 273250 UTSW Kdm5b 0.352 R3771 G1 225 Y 1 134613345 C725F G T missense Het probably damaging 1.000 0.492 phenotype 03/25/2015
29 273319 UTSW Lrp5 0.925 R3771 G1 225 Y 19 3612330 R173C G A missense Het probably damaging 1.000 0.560 phenotype 03/25/2015
30 273299 UTSW Lrrn3 0.192 R3771 G1 225 Y 12 41452870 I483L T A missense Het probably damaging 0.999 0.124 phenotype 03/25/2015
31 273281 UTSW Man2c1 0.000 R3771 G1 225 Y 9 57140377 C A unclassified Het probably benign phenotype 03/25/2015
32 273287 UTSW Med23 1.000 R3771 G1 225 Y 10 24902201 G810C G T missense Het probably damaging 0.997 0.208 phenotype 03/25/2015
33 273314 UTSW Nhlrc4 0.069 R3771 G1 225 Y 17 25943393 K127* T A nonsense Het probably null 0.608 03/25/2015
34 273300 UTSW Numb 1.000 R3771 G1 225 Y 12 83799576 D344G T C missense Het probably damaging 0.994 0.236 phenotype 03/25/2015
35 273260 UTSW Nup210l 0.365 R3771 G1 225 Y 3 90119894 Y194* T G nonsense Het probably null 0.684 phenotype 03/25/2015
36 273269 UTSW Ogg1 0.223 R3771 G1 225 Y 6 113333843 V317A T C missense Het possibly damaging 0.468 0.346 phenotype 03/25/2015
37 273293 UTSW Olfr822 0.068 R3771 G1 225 Y 10 130075274 Y288C A G missense Het probably damaging 1.000 0.064 phenotype 03/25/2015
38 273316 UTSW Olfr97 0.069 R3771 G1 225 Y 17 37231465 I302F T A missense Het possibly damaging 0.527 0.065 phenotype 03/25/2015
39 273264 UTSW Pclo 0.000 R3771 G1 225 Y 5 14539408 A T critical splice acceptor site Het probably null 0.492 phenotype 03/25/2015
40 273294 UTSW Pnpt1 1.000 R3771 G1 225 Y 11 29138174 M195T T C missense Het probably benign 0.055 0.136 phenotype 03/25/2015
41 273261 UTSW Polr3c 0.958 R3771 G1 225 Y 3 96725854 T43S T A missense Het probably damaging 0.996 0.020 03/25/2015
42 273317 UTSW Ptprs 1.000 R3771 G1 225 Y 17 56428978 T152A T C missense Het possibly damaging 0.585 0.060 phenotype 03/25/2015
43 473701 UTSW Rasl10b 0.160 R3771 G1 225 N 11 83418523 T134S A T missense Het probably benign 0.044 phenotype 04/14/2017
44 273258 UTSW Rin2 0.196 R3771 G1 225 Y 2 145860446 T354I C T missense Het probably benign 0.005 0.072 phenotype 03/25/2015
45 273315 UTSW Rnf39 0.052 R3771 G1 97 Y 17 36947229 W96R T C missense Het probably damaging 1.000 0.720 phenotype 03/25/2015
46 273290 UTSW Ros1 0.128 R3771 G1 225 Y 10 52128991 A949E G T missense Het probably damaging 0.972 0.042 phenotype 03/25/2015
47 273284 UTSW Rwdd2a 0.193 R3771 G1 225 Y 9 86574161 N130T A C missense Het possibly damaging 0.949 0.244 03/25/2015
48 273254 UTSW Scn9a 1.000 R3771 G1 225 Y 2 66483648 N1909D T C missense Het probably benign 0.259 0.054 phenotype 03/25/2015
49 273303 UTSW Ska3 0.909 R3771 G1 225 Y 14 57810077 V334I C T missense Het probably benign 0.057 0.060 phenotype 03/25/2015
50 273308 UTSW Srebf2 1.000 R3771 G1 209 Y 15 82182108 K579R A G missense Het probably benign 0.017 0.096 phenotype 03/25/2015
51 273266 UTSW Sun1 0.000 R3771 G1 225 Y 5 139238820 A G unclassified Het probably benign 0.066 phenotype 03/25/2015
52 273301 UTSW Tc2n 0.065 R3771 G1 225 Y 12 101694574 Q133L T A missense Het possibly damaging 0.675 0.034 03/25/2015
53 273280 UTSW Tecta 0.146 R3771 G1 171 Y 9 42330996 T2094A T C missense Het probably damaging 0.998 0.120 phenotype 03/25/2015
54 273297 UTSW Tex2 0.000 R3771 G1 225 Y 11 106546894 D650G T C missense Het unknown 0.170 03/25/2015
55 273306 UTSW Trio 1.000 R3771 G1 225 Y 15 27748091 S2492P A G missense Het probably damaging 0.975 0.206 phenotype 03/25/2015
56 273255 UTSW Ttn 1.000 R3771 G1 225 Y 2 76771367 T16872A T C missense Het probably benign 0.399 0.222 phenotype 03/25/2015
57 273263 UTSW Ugcg 1.000 R3771 G1 225 Y 4 59189690 F16S T C missense Het probably benign 0.000 0.066 phenotype 03/25/2015
58 273310 UTSW Usp16 1.000 R3771 G1 225 Y 16 87458683 M1T T C start codon destroyed Het probably null 1.000 0.468 phenotype 03/25/2015
59 273270 UTSW Vmn1r60 0.071 R3771 G1 225 N 7 5544711 C130F C A missense Het possibly damaging 0.757 03/25/2015
60 273313 UTSW Vmn2r101 0.082 R3771 G1 225 Y 17 19589657 D235G A G missense Het probably benign 0.000 0.114 03/25/2015
61 273291 UTSW Vpreb3 0.000 R3771 G1 209 Y 10 75939966 V26E A T missense Het probably benign 0.001 phenotype 03/25/2015
62 273257 UTSW Vps39 0.922 R3771 G1 225 Y 2 120342016 V179I C T missense Het possibly damaging 0.853 0.056 phenotype 03/25/2015
63 273259 UTSW Xrn2 0.964 R3771 G1 225 Y 2 147061287 V765A T C missense Het probably benign 0.115 0.055 phenotype 03/25/2015
64 273307 UTSW Zfp251 0.092 R3771 G1 225 Y 15 76853636 I414T A G missense Het possibly damaging 0.672 0.202 03/25/2015
65 273279 UTSW Zfp426 0.066 R3771 G1 225 Y 9 20473117 A T splice site Het probably null 0.614 phenotype 03/25/2015
66 273271 UTSW Zfp61 0.062 R3771 G1 225 Y 7 24295981 M1V T C start codon destroyed Het probably null 0.008 0.655 03/25/2015
[records 1 to 66 of 66]