Incidental Mutations

46 incidental mutations are currently displayed, and affect 45 genes.
5 are Possibly Damaging.
21 are Probably Damaging.
14 are Probably Benign.
5 are Probably Null.
0 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 46 of 46] per page Full List
ID question?
Source question?
Gene question?
E-score question?
Stock # question?
Gen question?
Vld question?
Strain question?
Chr question?
Position question?
Mutation question?
Type question?
Exon Dist question?
Zygosity question?
Predicted Effect question?
PPH Score question?
Meta Score question?
MGI Phenotype question?
Posted question?
1 273492 UTSW Acadm 0.000 R3774 G1 225 N 3 153933097 V213A A G missense Het probably benign 0.000 phenotype 03/25/2015
2 273486 UTSW Ccndbp1 0.123 R3774 G1 225 N 2 121009100 K26R A G missense Het possibly damaging 0.799 phenotype 03/25/2015
3 273504 UTSW Chrna10 0.162 R3774 G1 225 N 7 102114328 T87A T C missense Het probably benign 0.001 phenotype 03/25/2015
4 273494 UTSW Col27a1 1.000 R3774 G1 225 N 4 63314726 N360K T A missense Het probably benign 0.004 phenotype 03/25/2015
5 273510 UTSW Crispld2 1.000 R3774 G1 208 N 8 120029266 S325P T C missense Het probably damaging 0.986 phenotype 03/25/2015
6 273479 UTSW Dgkd 0.747 R3774 G1 225 N 1 87936300 I79N T A missense Het probably damaging 1.000 phenotype 03/25/2015
7 273503 UTSW Dhdh 0.089 R3774 G1 225 N 7 45481938 D157V T A missense Het probably benign 0.058 phenotype 03/25/2015
8 273520 UTSW Dnajc15 0.000 R3774 G1 225 N 14 77856937 A T critical splice donor site 2 bp Het probably null phenotype 03/25/2015
9 273496 UTSW Fbxo44 0.000 R3774 G1 225 N 4 148156594 F179L G T missense Het probably damaging 1.000 phenotype 03/25/2015
10 473729 UTSW Gm5565 0.140 R3774 G1 225 N 5 146158609 E192V T A missense Het probably benign 0.178 04/14/2017
11 273508 UTSW Gpat4 0.442 R3774 G1 225 N 8 23180155 P286L G A missense Het probably damaging 0.968 0.942 phenotype 03/25/2015
12 273485 UTSW Itgav 1.000 R3774 G1 225 N 2 83791964 E630G A G missense Het probably damaging 1.000 phenotype 03/25/2015
13 273525 UTSW Iws1 0.955 R3774 G1 225 N 18 32079995 S159P T C missense Het probably damaging 1.000 03/25/2015
14 273511 UTSW Kif23 0.973 R3774 G1 225 N 9 61924992 S623L G A missense Het probably benign 0.005 0.090 phenotype 03/25/2015
15 273516 UTSW Krt32 0.062 R3774 G1 225 N 11 100088121 C36R A G missense Het probably benign 0.003 0.094 phenotype 03/25/2015
16 273489 UTSW Med12l 0.261 R3774 G1 225 N 3 59247942 Q1181P A C missense Het probably damaging 0.971 0.082 phenotype 03/25/2015
17 273526 UTSW Megf10 0.558 R3774 G1 225 N 18 57277105 G653S G A missense Het probably damaging 1.000 0.909 phenotype 03/25/2015
18 273512 UTSW Mon1a 0.000 R3774 G1 188 N 9 107901303 Y242C A G missense Het probably damaging 1.000 03/25/2015
19 273524 UTSW Msh6 1.000 R3774 G1 225 N 17 87986181 R788L G T missense Het probably damaging 0.998 0.967 phenotype 03/25/2015
20 273491 UTSW Mttp 0.892 R3774 G1 225 N 3 138114263 T C splice site Het probably null phenotype 03/25/2015
21 273529 UTSW Mxi1 0.265 R3774 G1 225 N 19 53371729 A294E C A missense Het probably benign 0.177 0.090 phenotype 03/25/2015
22 273505 UTSW Olfm5 0.073 R3774 G1 181 N 7 104161849 R27S T A missense Het possibly damaging 0.666 03/25/2015
23 273506 UTSW Olfr667 0.525 R3774 G1 225 N 7 104916906 Y130F T A missense Het probably benign 0.014 phenotype 03/25/2015
24 273490 UTSW Palmd 0.079 R3774 G1 225 N 3 116927663 E81G T C missense Het probably damaging 1.000 03/25/2015
25 473727 UTSW Pecr 0.118 R3774 G1 225 N 1 72259371 F297L A G missense Het probably benign 0.001 04/14/2017
26 273519 UTSW Phf11b 0.116 R3774 G1 225 N 14 59326057 L137S A G missense Het probably benign 0.451 03/25/2015
27 273481 UTSW Phlpp1 0.136 R3774 G1 109 N 1 106393191 GAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC GAGCAGCAGCAGCAGCAGCAGCAGCAGC small deletion Het probably benign phenotype 03/25/2015
28 273487 UTSW Plcb4 0.000 R3774 G1 225 N 2 135958145 K472E A G missense Het probably benign 0.001 phenotype 03/25/2015
29 273495 UTSW Pomgnt1 0.000 R3774 G1 225 N 4 116154128 R230H G A missense Het probably damaging 0.995 0.106 phenotype 03/25/2015
30 273484 UTSW Pomt1 0.125 R3774 G1 225 N 2 32244250 H261R A G missense Het possibly damaging 0.933 phenotype 03/25/2015
31 273515 UTSW Ppm1d 1.000 R3774 G1 225 N 11 85337167 I303T T C missense Het probably damaging 0.999 0.931 phenotype 03/25/2015
32 273482 UTSW Ptprc 0.000 R3774 G1 225 N 1 138064773 Q1205H T G missense Het probably damaging 0.972 0.468 phenotype 03/25/2015
33 273493 UTSW Rad23b 1.000 R3774 G1 225 N 4 55382589 T264I C T missense Het possibly damaging 0.953 phenotype 03/25/2015
34 273497 UTSW Rfc1 1.000 R3774 G1 225 N 5 65264406 Y1050C T C missense Het probably damaging 1.000 phenotype 03/25/2015
35 273513 UTSW Sept8 0.172 R3774 G1 225 N 11 53537579 V352A T C missense Het probably damaging 1.000 phenotype 03/25/2015
36 273501 UTSW Slc25a13 0.508 R3774 G1 225 N 6 6109288 Q358L T A missense Het probably damaging 0.999 0.943 phenotype 03/25/2015
37 273498 UTSW Ssh1 0.000 R3774 G1 140 N 5 113966722 D12G T C missense Het probably damaging 1.000 phenotype 03/25/2015
38 273509 UTSW Tmem59l 0.058 R3774 G1 108 N 8 70487301 L6S A G missense Het unknown 0.087 phenotype 03/25/2015
39 273488 UTSW Tnik 0.000 R3774 G1 225 N 3 28638419 Y820H T C missense Het probably damaging 0.984 0.064 phenotype 03/25/2015
40 273527 UTSW Trpm3 0.082 R3774 G1 225 N 19 22978602 F1143L T C missense Het possibly damaging 0.664 phenotype 03/25/2015
41 273528 UTSW Trpm3 0.082 R3774 G1 225 N 19 22987975 S1611R T A missense Het probably benign 0.031 phenotype 03/25/2015
42 273500 UTSW Ttyh3 0.103 R3774 G1 118 N 5 140648734 F32L A G missense Het probably damaging 0.990 phenotype 03/25/2015
43 273522 UTSW Unkl 0.243 R3774 G1 111 N 17 25188407 T A splice site Het probably null phenotype 03/25/2015
44 273502 UTSW Vwf 0.144 R3774 G1 225 N 6 125649099 T A splice site Het probably null phenotype 03/25/2015
45 273507 UTSW Wdr11 0.170 R3774 G1 225 N 7 129631693 T A splice site Het probably null phenotype 03/25/2015
46 273521 UTSW Yeats2 0.966 R3774 G1 225 N 16 20150495 D12G A G missense Het probably damaging 1.000 phenotype 03/25/2015
[records 1 to 46 of 46]