Incidental Mutations

46 incidental mutations are currently displayed, and affect 45 genes.
5 are Possibly Damaging.
21 are Probably Damaging.
14 are Probably Benign.
5 are Probably Null.
0 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 46 of 46] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 273492 UTSW Acadm 0.000 R3774 G1 225 N 3 153933097 V213A A G missense Het probably benign 0.000 phenotype 03/25/2015
2 273486 UTSW Ccndbp1 0.157 R3774 G1 225 N 2 121009100 K26R A G missense Het possibly damaging 0.799 phenotype 03/25/2015
3 273504 UTSW Chrna10 0.187 R3774 G1 225 N 7 102114328 T87A T C missense Het probably benign 0.001 phenotype 03/25/2015
4 273494 UTSW Col27a1 1.000 R3774 G1 225 N 4 63314726 N360K T A missense Het probably benign 0.004 phenotype 03/25/2015
5 273510 UTSW Crispld2 1.000 R3774 G1 208 N 8 120029266 S325P T C missense Het probably damaging 0.986 phenotype 03/25/2015
6 273479 UTSW Dgkd 0.777 R3774 G1 225 N 1 87936300 I79N T A missense Het probably damaging 1.000 phenotype 03/25/2015
7 273503 UTSW Dhdh 0.090 R3774 G1 225 N 7 45481938 D157V T A missense Het probably benign 0.058 phenotype 03/25/2015
8 273520 UTSW Dnajc15 0.000 R3774 G1 225 N 14 77856937 A T critical splice donor site 2 bp Het probably null phenotype 03/25/2015
9 273496 UTSW Fbxo44 0.000 R3774 G1 225 N 4 148156594 F179L G T missense Het probably damaging 1.000 phenotype 03/25/2015
10 473729 UTSW Gm5565 0.218 R3774 G1 225 N 5 146158609 E192V T A missense Het probably benign 0.178 04/14/2017
11 273508 UTSW Gpat4 0.417 R3774 G1 225 N 8 23180155 P286L G A missense Het probably damaging 0.968 0.942 phenotype 03/25/2015
12 273485 UTSW Itgav 1.000 R3774 G1 225 N 2 83791964 E630G A G missense Het probably damaging 1.000 phenotype 03/25/2015
13 273525 UTSW Iws1 0.964 R3774 G1 225 N 18 32079995 S159P T C missense Het probably damaging 1.000 03/25/2015
14 273511 UTSW Kif23 0.971 R3774 G1 225 N 9 61924992 S623L G A missense Het probably benign 0.005 0.090 phenotype 03/25/2015
15 273516 UTSW Krt32 0.078 R3774 G1 225 N 11 100088121 C36R A G missense Het probably benign 0.003 0.094 phenotype 03/25/2015
16 273489 UTSW Med12l 0.426 R3774 G1 225 N 3 59247942 Q1181P A C missense Het probably damaging 0.971 0.082 phenotype 03/25/2015
17 273526 UTSW Megf10 0.497 R3774 G1 225 N 18 57277105 G653S G A missense Het probably damaging 1.000 0.909 phenotype 03/25/2015
18 273512 UTSW Mon1a 0.000 R3774 G1 188 N 9 107901303 Y242C A G missense Het probably damaging 1.000 03/25/2015
19 273524 UTSW Msh6 1.000 R3774 G1 225 N 17 87986181 R788L G T missense Het probably damaging 0.998 0.967 phenotype 03/25/2015
20 273491 UTSW Mttp 0.772 R3774 G1 225 N 3 138114263 T C intron Het probably null phenotype 03/25/2015
21 273529 UTSW Mxi1 0.402 R3774 G1 225 N 19 53371729 A294E C A missense Het probably benign 0.177 0.090 phenotype 03/25/2015
22 273505 UTSW Olfm5 0.066 R3774 G1 181 N 7 104161849 R27S T A missense Het possibly damaging 0.666 03/25/2015
23 273506 UTSW Olfr667 0.710 R3774 G1 225 N 7 104916906 Y130F T A missense Het probably benign 0.014 phenotype 03/25/2015
24 273490 UTSW Palmd 0.073 R3774 G1 225 N 3 116927663 E81G T C missense Het probably damaging 1.000 03/25/2015
25 473727 UTSW Pecr 0.123 R3774 G1 225 N 1 72259371 F297L A G missense Het probably benign 0.001 04/14/2017
26 273519 UTSW Phf11b 0.156 R3774 G1 225 N 14 59326057 L137S A G missense Het probably benign 0.451 03/25/2015
27 273481 UTSW Phlpp1 0.262 R3774 G1 109 N 1 106393191 GAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC GAGCAGCAGCAGCAGCAGCAGCAGCAGC small deletion Het probably benign phenotype 03/25/2015
28 273487 UTSW Plcb4 0.000 R3774 G1 225 N 2 135958145 K472E A G missense Het probably benign 0.001 phenotype 03/25/2015
29 273495 UTSW Pomgnt1 0.000 R3774 G1 225 N 4 116154128 R230H G A missense Het probably damaging 0.995 0.106 phenotype 03/25/2015
30 273484 UTSW Pomt1 0.232 R3774 G1 225 N 2 32244250 H261R A G missense Het possibly damaging 0.933 phenotype 03/25/2015
31 273515 UTSW Ppm1d 1.000 R3774 G1 225 N 11 85337167 I303T T C missense Het probably damaging 0.999 0.931 phenotype 03/25/2015
32 273482 UTSW Ptprc 0.325 R3774 G1 225 N 1 138064773 Q1205H T G missense Het probably damaging 0.972 0.468 phenotype 03/25/2015
33 273493 UTSW Rad23b 1.000 R3774 G1 225 N 4 55382589 T264I C T missense Het possibly damaging 0.953 phenotype 03/25/2015
34 273497 UTSW Rfc1 1.000 R3774 G1 225 N 5 65264406 Y1050C T C missense Het probably damaging 1.000 phenotype 03/25/2015
35 273513 UTSW Sept8 0.163 R3774 G1 225 N 11 53537579 V352A T C missense Het probably damaging 1.000 phenotype 03/25/2015
36 273501 UTSW Slc25a13 0.302 R3774 G1 225 N 6 6109288 Q358L T A missense Het probably damaging 0.999 0.943 phenotype 03/25/2015
37 273498 UTSW Ssh1 0.000 R3774 G1 140 N 5 113966722 D12G T C missense Het probably damaging 1.000 phenotype 03/25/2015
38 273509 UTSW Tmem59l 0.062 R3774 G1 108 N 8 70487301 L6S A G missense Het unknown 0.087 phenotype 03/25/2015
39 273488 UTSW Tnik 0.000 R3774 G1 225 N 3 28638419 Y820H T C missense Het probably damaging 0.984 0.064 phenotype 03/25/2015
40 273527 UTSW Trpm3 0.207 R3774 G1 225 N 19 22978602 F1143L T C missense Het possibly damaging 0.664 phenotype 03/25/2015
41 273528 UTSW Trpm3 0.207 R3774 G1 225 N 19 22987975 S1611R T A missense Het probably benign 0.031 phenotype 03/25/2015
42 273500 UTSW Ttyh3 0.093 R3774 G1 118 N 5 140648734 F32L A G missense Het probably damaging 0.990 phenotype 03/25/2015
43 273522 UTSW Unkl 0.288 R3774 G1 111 N 17 25188407 T A unclassified Het probably null phenotype 03/25/2015
44 273502 UTSW Vwf 0.277 R3774 G1 225 N 6 125649099 T A intron Het probably null phenotype 03/25/2015
45 273507 UTSW Wdr11 0.126 R3774 G1 225 N 7 129631693 T A splice site Het probably null phenotype 03/25/2015
46 273521 UTSW Yeats2 0.958 R3774 G1 225 N 16 20150495 D12G A G missense Het probably damaging 1.000 phenotype 03/25/2015
[records 1 to 46 of 46]