Incidental Mutations

44 incidental mutations are currently displayed, and affect 44 genes.
8 are Possibly Damaging.
18 are Probably Damaging.
13 are Probably Benign.
2 are Probably Null.
0 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 44 of 44] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 271982 UTSW 2310079G19Rik 0.089 R3779 G1 225 Y 16 88627385 C73R A G missense Het probably damaging 0.994 0.647 03/25/2015
2 271980 UTSW Acot10 0.109 R3779 G1 225 Y 15 20665542 V371A A G missense Het probably damaging 0.977 0.366 03/25/2015
3 271955 UTSW Ambn 0.111 R3779 G1 225 Y 5 88465342 C A splice site Het probably benign 0.090 phenotype 03/25/2015
4 271947 UTSW Ankrd34a 0.121 R3779 G1 225 Y 3 96598931 F484L T C missense Het possibly damaging 0.845 0.091 03/25/2015
5 271971 UTSW Bcl11a 1.000 R3779 G1 225 Y 11 24164568 K637R A G missense Het probably damaging 1.000 0.151 phenotype 03/25/2015
6 271949 UTSW Cenpe 1.000 R3779 G1 225 Y 3 135256576 S1968P T C missense Het possibly damaging 0.873 0.112 phenotype 03/25/2015
7 271945 UTSW Cfap61 0.000 R3779 G1 225 Y 2 145950794 I52T T C missense Het probably damaging 0.997 0.554 03/25/2015
8 271958 UTSW Cit 0.949 R3779 G1 225 Y 5 115859341 M128L A T missense Het probably benign 0.011 0.089 phenotype 03/25/2015
9 271954 UTSW Cnga1 0.287 R3779 G1 225 Y 5 72604783 L463I G T missense Het probably damaging 0.999 0.647 phenotype 03/25/2015
10 271974 UTSW Dnah11 0.605 R3779 G1 225 Y 12 118130713 C T splice site Het probably benign phenotype 03/25/2015
11 271966 UTSW Elovl4 1.000 R3779 G1 217 Y 9 83785148 ACT A frame shift Het probably null 0.976 phenotype 03/25/2015
12 271957 UTSW Ep400 1.000 R3779 G1 225 Y 5 110691649 I1853T A G missense Het unknown 0.240 phenotype 03/25/2015
13 271946 UTSW Flg2 0.102 R3779 G1 225 Y 3 93202423 S586L C T missense Het unknown 0.105 03/25/2015
14 271968 UTSW Gm10608 0.082 R3779 G1 110 N 9 119160716 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA small deletion Het probably benign 0.090 03/25/2015
15 271988 UTSW Gm21886 0.074 R3779 G1 225 Y 18 80089434 Q170K G T missense Het possibly damaging 0.937 0.179 03/25/2015
16 271986 UTSW Gm5819 0.379 R3779 G1 151 Y 18 8694429 E118G A G missense Het probably damaging 0.998 0.550 03/25/2015
17 271979 UTSW Gm9376 0.214 R3779 G1 225 Y 14 118267315 V53A T C missense Het probably benign 0.326 0.090 03/25/2015
18 271983 UTSW H2-T3 0.000 R3779 G1 225 Y 17 36189682 T90A T C missense Het probably damaging 0.988 0.647 phenotype 03/25/2015
19 271990 UTSW Hif1an 0.765 R3779 G1 225 Y 19 44569408 D243G A G missense Het probably damaging 1.000 0.605 phenotype 03/25/2015
20 271948 UTSW Hmgcs2 0.118 R3779 G1 225 Y 3 98299112 C T splice site Het probably benign 0.090 phenotype 03/25/2015
21 473540 UTSW Ighv1-72 0.203 R3779 G1 191 N 12 115758016 S107T A T missense Het probably damaging 0.988 04/14/2017
22 271951 UTSW Jak1 1.000 R3779 G1 225 Y 4 101156490 H1014Y G A missense Het probably benign 0.403 0.090 phenotype 03/25/2015
23 271960 UTSW Klrb1c 0.054 R3779 G1 225 Y 6 128780343 D253G T C missense Het probably damaging 0.999 0.647 phenotype 03/25/2015
24 271972 UTSW Lpin1 0.491 R3779 G1 225 Y 12 16564568 T404M G A missense Het probably damaging 0.964 0.647 phenotype 03/25/2015
25 271973 UTSW Map3k9 0.000 R3779 G1 225 Y 12 81743791 A T splice site Het probably benign phenotype 03/25/2015
26 271984 UTSW Myl12a 0.419 R3779 G1 225 Y 17 70994636 H165Q G T missense Het possibly damaging 0.927 0.179 phenotype 03/25/2015
27 271970 UTSW Olfr768 0.055 R3779 G1 225 Y 10 129093296 F226S A G missense Het possibly damaging 0.938 0.179 phenotype 03/25/2015
28 271987 UTSW Pdgfrb 1.000 R3779 G1 225 Y 18 61072666 S575T T A missense Het probably damaging 0.998 0.218 phenotype 03/25/2015
29 271981 UTSW Phldb2 0.000 R3779 G1 225 Y 16 45748755 Y1247C T C missense Het probably damaging 1.000 0.399 03/25/2015
30 271961 UTSW Pinlyp 0.075 R3779 G1 207 Y 7 24541835 T181S T A missense Het probably benign 0.205 0.061 03/25/2015
31 271950 UTSW Pkn2 1.000 R3779 G1 225 Y 3 142793980 V928A A G missense Het possibly damaging 0.888 0.170 phenotype 03/25/2015
32 271952 UTSW Skint5 0.063 R3779 G1 225 Y 4 113779040 C T splice site Het probably benign 03/25/2015
33 271977 UTSW Skiv2l2 0.965 R3779 G1 225 Y 13 112903392 A T splice site Het probably benign 03/25/2015
34 271965 UTSW Slc24a1 0.140 R3779 G1 225 Y 9 64948297 Y443H A G missense Het unknown 0.457 phenotype 03/25/2015
35 271975 UTSW Sp8 0.760 R3779 G1 225 Y 12 118849015 V202L G T missense Het possibly damaging 0.842 0.093 phenotype 03/25/2015
36 271985 UTSW Svil 0.233 R3779 G1 225 Y 18 5090855 N915S A G missense Het probably damaging 0.973 0.647 phenotype 03/25/2015
37 271967 UTSW Syncrip 0.666 R3779 G1 225 Y 9 88476939 D172E A C missense Het probably damaging 1.000 0.189 phenotype 03/25/2015
38 271959 UTSW Tex26 0.077 R3779 G1 225 Y 5 149445851 I48T T C missense Het probably damaging 0.963 0.238 03/25/2015
39 271989 UTSW Trpm6 1.000 R3779 G1 225 Y 19 18876039 I1808L A C missense Het possibly damaging 0.801 0.273 phenotype 03/25/2015
40 271963 UTSW Uba2 1.000 R3779 G1 225 Y 7 34154646 T C critical splice acceptor site Het probably null 0.950 phenotype 03/25/2015
41 271978 UTSW Vwa8 0.000 R3779 G1 210 Y 14 79102322 T A splice site Het probably benign 03/25/2015
42 271953 UTSW Wfs1 0.474 R3779 G1 225 Y 5 36968624 V308L C A missense Het probably benign 0.015 0.090 phenotype 03/25/2015
43 271964 UTSW Wrn 0.515 R3779 G1 225 Y 8 33241020 R1095W T A missense Het probably damaging 1.000 0.647 phenotype 03/25/2015
44 271976 UTSW Zfp808 0.074 R3779 G1 200 N 13 62171903 N315K T A missense Het probably damaging 0.966 03/25/2015
[records 1 to 44 of 44]