Incidental Mutations

52 incidental mutations are currently displayed, and affect 50 genes.
7 are Possibly Damaging.
22 are Probably Damaging.
14 are Probably Benign.
8 are Probably Null.
4 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 52 of 52] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 274980 UTSW Adat1 0.096 R3807 G1 225 N 8 111990370 W2R A T missense Het probably damaging 1.000 phenotype 04/02/2015
2 274982 UTSW Arhgap42 0.916 R3807 G1 225 N 9 9008033 I563T A G missense Het probably damaging 0.979 phenotype 04/02/2015
3 275008 UTSW Armcx1 R3807 G1 222 N X 134721265 V372A T C missense Het probably damaging 0.972 phenotype 04/02/2015
4 274967 UTSW Bicd1 0.000 R3807 G1 225 N 6 149518991 L780M T A missense Het probably damaging 1.000 0.647 phenotype 04/02/2015
5 274958 UTSW Bpifb1 0.000 R3807 G1 225 N 2 154214002 N329K C A missense Het probably benign 0.254 phenotype 04/02/2015
6 274979 UTSW Ccdc113 0.075 R3807 G1 225 N 8 95542653 N193I A T missense Het probably damaging 1.000 04/02/2015
7 274998 UTSW Cebpz 0.967 R3807 G1 225 N 17 78935418 L269Q A T missense Het probably damaging 1.000 phenotype 04/02/2015
8 274976 UTSW Cttn 0.219 R3807 G1 225 N 7 144445851 V290M C T missense Het probably damaging 0.999 phenotype 04/02/2015
9 274970 UTSW Ctu1 0.846 R3807 G1 225 N 7 43676673 L252P T C missense Het probably damaging 0.999 0.926 04/02/2015
10 274975 UTSW Dmbt1 0.222 R3807 G1 225 N 7 131112090 M1455K T A missense Het possibly damaging 0.770 phenotype 04/02/2015
11 274986 UTSW Eme1 0.000 R3807 G1 225 N 11 94650592 W135R A G missense Het probably damaging 0.997 phenotype 04/02/2015
12 275002 UTSW Entpd7 0.105 R3807 G1 225 N 19 43725540 T G critical splice donor site 2 bp Het probably null phenotype 04/02/2015
13 274974 UTSW Eri2 0.196 R3807 G1 225 N 7 119786008 C423* A T nonsense Het probably null 0.964 04/02/2015
14 274977 UTSW Erich1 0.099 R3807 G1 225 N 8 14033695 N125S T C missense Het probably benign 0.112 04/02/2015
15 274978 UTSW Fam149a 0.000 R3807 G1 225 N 8 45381610 T51S T A missense Het possibly damaging 0.909 04/02/2015
16 274985 UTSW Fam71b 0.000 R3807 G1 225 N 11 46404953 A51T G A missense Het possibly damaging 0.773 04/02/2015
17 274959 UTSW Fer1l4 0.000 R3807 G1 225 N 2 156045683 G531D C T missense Het probably damaging 1.000 04/02/2015
18 274960 UTSW Frem2 1.000 R3807 G1 225 N 3 53653449 D1212E A T missense Het probably benign 0.225 phenotype 04/02/2015
19 274965 UTSW Get4 1.000 R3807 G1 192 N 5 139252531 V23F G T missense Het probably damaging 0.983 0.151 04/02/2015
20 274987 UTSW Gm11595 0.089 R3807 G1 175 N 11 99772554 R100H C T missense Het unknown 04/02/2015
21 473943 UTSW Gria1 0.000 R3807 G1 225 N 11 57310678 W712R T C missense Het probably damaging 1.000 phenotype 04/14/2017
22 274971 UTSW Herc2 0.953 R3807 G1 225 N 7 56207809 N4047D A G missense Het probably damaging 0.998 phenotype 04/02/2015
23 274994 UTSW Hoxc9 0.000 R3807 G1 225 N 15 102981684 Y11C A G missense Het possibly damaging 0.943 phenotype 04/02/2015
24 274983 UTSW Lama2 0.288 R3807 G1 217 N 10 27190665 GCCC GCC frame shift Het probably null phenotype 04/02/2015
25 473940 UTSW Lrrc56 0.098 R3807 G1 225 N 7 141209385 T393A A G missense Het probably benign 0.000 04/14/2017
26 274963 UTSW Lrrc7 0.750 R3807 G1 225 N 3 158185493 I346V T C missense Het probably benign 0.100 0.089 phenotype 04/02/2015
27 275006 UTSW Med14 0.933 R3807 G1 222 N X 12687177 Y463C T C missense Het probably damaging 1.000 phenotype 04/02/2015
28 274993 UTSW Nalcn 1.000 R3807 G1 225 N 14 123278187 D1734V T A missense Het probably damaging 0.997 phenotype 04/02/2015
29 274966 UTSW Nfe2l3 0.000 R3807 G1 225 N 6 51457377 R306* A T nonsense Het probably null phenotype 04/02/2015
30 275003 UTSW Nolc1 0.000 R3807 G1 217 N 19 46081352 CCAGCAGCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGCAGCAGCAGCAGC small insertion Het probably benign 04/02/2015
31 275004 UTSW Nolc1 0.000 R3807 G1 142 N 19 46081359 CAG CAGAAG small insertion Het probably benign 04/02/2015
32 275005 UTSW Nolc1 0.000 R3807 G1 137 N 19 46081371 CAG CAGAAG small insertion Het probably benign 04/02/2015
33 274962 UTSW Npr1 0.122 R3807 G1 225 N 3 90458726 V586E A T missense Het probably damaging 0.984 phenotype 04/02/2015
34 473944 UTSW Olfr192 0.140 R3807 G1 225 N 16 59098843 *50G A C makesense Het probably null 04/14/2017
35 274973 UTSW Olfr715b 0.180 R3807 G1 225 N 7 107106463 S133P A G missense Het probably benign 0.009 04/02/2015
36 274999 UTSW Pcdhb4 0.060 R3807 G1 225 N 18 37309314 F559S T C missense Het probably damaging 0.975 04/02/2015
37 274988 UTSW Psmd12 0.958 R3807 G1 225 N 11 107495765 D387E T G missense Het probably benign 0.029 phenotype 04/02/2015
38 274984 UTSW Psme4 0.000 R3807 G1 225 N 11 30856027 T A splice site Het probably null phenotype 04/02/2015
39 274991 UTSW Ptch1 1.000 R3807 G1 225 N 13 63524959 E944A T G missense Het probably benign 0.003 0.137 phenotype 04/02/2015
40 274997 UTSW Rgs11 0.190 R3807 G1 225 N 17 26203500 I69F A T missense Het probably damaging 0.991 phenotype 04/02/2015
41 274969 UTSW Ryr1 1.000 R3807 G1 219 N 7 29020152 A4277T C T missense Het probably damaging 1.000 phenotype 04/02/2015
42 275000 UTSW Setbp1 0.488 R3807 G1 225 N 18 78783322 V1359I C T missense Het probably benign 0.006 phenotype 04/02/2015
43 274961 UTSW Sis 0.000 R3807 G1 225 N 3 72925596 V956E A T missense Het probably benign 0.007 phenotype 04/02/2015
44 274981 UTSW Slc35f3 0.180 R3807 G1 225 N 8 126389239 W302R T A missense Het probably damaging 1.000 04/02/2015
45 274989 UTSW Syt16 0.000 R3807 G1 225 N 12 74229398 E212G A G missense Het possibly damaging 0.934 04/02/2015
46 274990 UTSW Tdp2 0.665 R3807 G1 225 N 13 24831793 S21* C A nonsense Het probably null phenotype 04/02/2015
47 274995 UTSW Tfrc 1.000 R3807 G1 225 N 16 32616826 N173I A T missense Het possibly damaging 0.466 phenotype 04/02/2015
48 274964 UTSW Tmem132b 0.087 R3807 G1 225 N 5 125787580 I917F A T missense Het probably damaging 0.999 04/02/2015
49 275007 UTSW Vbp1 R3807 G1 222 N X 75523342 V122A T C missense Het probably damaging 0.999 phenotype 04/02/2015
50 274996 UTSW Vmn1r225 0.064 R3807 G1 225 N 17 20502852 W185* G A nonsense Het probably null 04/02/2015
51 274968 UTSW Vmn1r70 0.079 R3807 G1 225 N 7 10633788 T68A A G missense Het probably benign 0.012 04/02/2015
52 275001 UTSW Zfp518a 0.897 R3807 G1 225 N 19 40914797 K1057E A G missense Het possibly damaging 0.897 phenotype 04/02/2015
[records 1 to 52 of 52]