Incidental Mutations

35 incidental mutations are currently displayed, and affect 35 genes.
4 are Possibly Damaging.
9 are Probably Damaging.
16 are Probably Benign.
5 are Probably Null.
1 create premature stop codons.
0 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 35 of 35] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 276585 UTSW Aldh1a1 0.822 R3871 G1 225 N 19 20624753 Y225* T A nonsense Het probably null phenotype 04/06/2015
2 276548 UTSW Bard1 1.000 R3871 G1 225 N 1 71074940 K294R T C missense Het probably benign 0.049 phenotype 04/06/2015
3 276570 UTSW Bcap29 0.127 R3871 G1 225 N 12 31617081 S194T A T missense Het probably benign 0.072 04/06/2015
4 276569 UTSW Ccdc40 0.158 R3871 G1 225 N 11 119264281 V1116M G A missense Het probably damaging 1.000 phenotype 04/06/2015
5 276549 UTSW Cntnap5a 0.000 R3871 G1 225 N 1 116060249 E170G A G missense Het probably damaging 1.000 0.450 phenotype 04/06/2015
6 276579 UTSW Crygs 0.000 R3871 G1 225 N 16 22805551 G102D C T missense Het possibly damaging 0.927 0.179 phenotype 04/06/2015
7 276586 UTSW Cyp2c54 0.101 R3871 G1 225 N 19 40072423 D92G T C missense Het probably benign 0.366 04/06/2015
8 276558 UTSW Dpp6 0.102 R3871 G1 225 N 5 27469465 F197L T C missense Het probably benign 0.033 phenotype 04/06/2015
9 276582 UTSW Filip1l 0.000 R3871 G1 225 N 16 57513286 K147N G T missense Het probably damaging 0.974 04/06/2015
10 276554 UTSW Hrnr 0.000 R3871 G1 225 N 3 93331874 S3140T T A missense Het unknown 04/06/2015
11 276550 UTSW Igfn1 0.081 R3871 G1 225 N 1 135968836 H1331N G T missense Het probably benign 0.031 04/06/2015
12 276581 UTSW Kalrn 0.934 R3871 G1 200 N 16 34203856 C T splice site 5 bp Het probably null phenotype 04/06/2015
13 276578 UTSW Kmt2d 1.000 R3871 G1 180 N 15 98851021 TTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGC unclassified Het probably benign phenotype 04/06/2015
14 276577 UTSW Mfng 0.214 R3871 G1 225 N 15 78756621 L308P A G missense Het probably damaging 0.999 phenotype 04/06/2015
15 276565 UTSW Nt5e 0.000 R3871 G1 225 N 9 88364693 N327K C A missense Het probably benign 0.039 phenotype 04/06/2015
16 276552 UTSW Olfr1025-ps1 0.076 R3871 G1 225 N 2 85918582 T G splice site Het probably null 04/06/2015
17 276573 UTSW Pgbd1 0.000 R3871 G1 225 N 13 21434370 R39H C T missense Het possibly damaging 0.948 0.179 phenotype 04/06/2015
18 276556 UTSW Phactr4 1.000 R3871 G1 225 N 4 132377249 T256A T C missense Het probably benign 0.003 phenotype 04/06/2015
19 276574 UTSW Rab24 0.000 R3871 G1 225 N 13 55321179 D63G T C missense Het probably damaging 1.000 phenotype 04/06/2015
20 276576 UTSW Rubcnl 0.096 R3871 G1 225 N 14 75040916 P380L C T missense Het probably benign 0.001 0.090 04/06/2015
21 276547 UTSW Satb2 1.000 R3871 G1 225 N 1 56891220 S215P A G missense Het probably damaging 0.999 0.215 phenotype 04/06/2015
22 276572 UTSW Serpina3b 0.059 R3871 G1 225 N 12 104138788 I408F A T missense Het probably damaging 0.998 04/06/2015
23 276551 UTSW Setx 0.000 R3871 G1 225 N 2 29145741 D746G A G missense Het probably damaging 0.981 phenotype 04/06/2015
24 276567 UTSW Sf3a2 0.958 R3871 G1 139 N 10 80804693 A C unclassified Het probably benign 04/06/2015
25 276564 UTSW Snx33 0.073 R3871 G1 225 N 9 56926740 N15S T C missense Het probably benign 0.050 0.073 phenotype 04/06/2015
26 276583 UTSW Snx9 0.763 R3871 G1 225 N 17 5891781 P61L C T missense Het probably benign 0.003 phenotype 04/06/2015
27 276561 UTSW Sult2a6 0.058 R3871 G1 225 N 7 14254776 K20E T C missense Het probably benign 0.161 phenotype 04/06/2015
28 276560 UTSW Tas2r122 0.045 R3871 G1 225 N 6 132711580 S117P A G missense Het probably benign 0.003 04/06/2015
29 276566 UTSW Tmem26 0.098 R3871 G1 225 N 10 68778732 E326K G A missense Het probably benign 0.011 phenotype 04/06/2015
30 276563 UTSW Tnpo2 0.000 R3871 G1 225 N 8 85054751 C789S T A missense Het probably null 0.983 04/06/2015
31 276571 UTSW Togaram1 0.895 R3871 G1 225 N 12 65002645 E1285D A C missense Het probably benign 0.002 0.059 04/06/2015
32 276580 UTSW Ubxn7 1.000 R3871 G1 225 N 16 32381430 S335T T A missense Het possibly damaging 0.942 04/06/2015
33 276559 UTSW Unc119b 0.000 R3871 G1 225 N 5 115130508 T106M G A missense Het probably damaging 1.000 04/06/2015
34 276584 UTSW Usp14 1.000 R3871 G1 225 N 18 10002370 S314P A G missense Het possibly damaging 0.891 0.556 phenotype 04/06/2015
35 276568 UTSW Usp32 1.000 R3871 G1 225 N 11 85081156 D129G T C missense Het probably null 0.807 04/06/2015
[records 1 to 35 of 35]