Incidental Mutations

43 incidental mutations are currently displayed, and affect 43 genes.
9 are Possibly Damaging.
15 are Probably Damaging.
13 are Probably Benign.
6 are Probably Null.
0 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 43 of 43] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 308953 UTSW 4833439L19Rik 0.084 R3900 G1 225 Y 13 54552968 S212R A T missense Het probably damaging 0.992 0.066 04/17/2015
2 308918 UTSW AI182371 0.050 R3900 G1 225 Y 2 35085216 I334V T C missense Het probably benign 0.010 0.090 04/17/2015
3 308932 UTSW Anpep 0.000 R3900 G1 225 Y 7 79839225 S372P A G missense Het probably benign 0.070 0.235 phenotype 04/17/2015
4 366026 UTSW Apc2 0.222 R3900 G1 55 Y 10 80295972 C A unclassified Het probably null 0.976 phenotype 12/21/2015
5 308957 UTSW Bcl6 0.944 R3900 G1 225 Y 16 23977554 E41A T G missense Het possibly damaging 0.943 0.279 phenotype 04/17/2015
6 308928 UTSW Brpf1 0.962 R3900 G1 225 Y 6 113318433 I674V A G missense Het probably benign 0.202 0.066 phenotype 04/17/2015
7 308935 UTSW Cherp 0.962 R3900 G1 225 Y 8 72469936 I201T A G missense Het possibly damaging 0.625 0.528 04/17/2015
8 308945 UTSW Cluh 0.254 R3900 G1 225 Y 11 74667104 H1056R A G missense Het probably benign 0.288 0.483 phenotype 04/17/2015
9 308929 UTSW Csgalnact2 0.231 R3900 G1 225 Y 6 118121014 F122I A T missense Het probably damaging 1.000 0.916 phenotype 04/17/2015
10 308917 UTSW Cubn 1.000 R3900 G1 225 Y 2 13286980 C A critical splice donor site 1 bp Het probably null 0.948 phenotype 04/17/2015
11 308947 UTSW Dnah17 0.000 R3900 G1 225 Y 11 118094808 I1481N A T missense Het possibly damaging 0.784 0.073 phenotype 04/17/2015
12 308920 UTSW Eif2ak4 0.000 R3900 G1 225 Y 2 118475029 Y1561C A G missense Het probably damaging 1.000 0.300 phenotype 04/17/2015
13 308927 UTSW Elfn1 0.133 R3900 G1 225 Y 5 139971964 R241H G A missense Het probably damaging 0.999 0.116 phenotype 04/17/2015
14 308951 UTSW Eml5 0.352 R3900 G1 225 Y 12 98825523 R1245C G A missense Het probably damaging 1.000 0.434 04/17/2015
15 308933 UTSW Fchsd2 0.214 R3900 G1 225 Y 7 101191799 K172E A G missense Het possibly damaging 0.904 0.290 04/17/2015
16 308942 UTSW Gm10608 0.082 R3900 G1 142 N 9 119160716 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA frame shift Het probably null 0.976 04/17/2015
17 308959 UTSW Gm6133 0.843 R3900 G1 145 Y 18 78350150 N120D A G missense Het probably benign 0.217 0.090 04/17/2015
18 308943 UTSW Hivep2 0.834 R3900 G1 225 Y 10 14128969 T437K C A missense Het probably benign 0.160 0.090 phenotype 04/17/2015
19 308914 UTSW Igsf9 0.000 R3900 G1 225 Y 1 172489558 L35P T C missense Het probably damaging 0.999 0.621 phenotype 04/17/2015
20 474452 UTSW Khdc3 0.110 R3900 G1 225 N 9 73104346 T C intron Het probably benign phenotype 04/14/2017
21 308954 UTSW Mmrn2 0.049 R3900 G1 225 Y 14 34399560 G T unclassified 1632 bp Het probably null 0.114 phenotype 04/17/2015
22 308931 UTSW Mrgpra1 0.053 R3900 G1 225 Y 7 47335527 R135S G T missense Het possibly damaging 0.762 0.179 04/17/2015
23 308919 UTSW Olfr1201 0.051 R3900 G1 225 Y 2 88794929 L182F A T missense Het possibly damaging 0.881 0.179 phenotype 04/17/2015
24 308936 UTSW Olfr971 0.069 R3900 G1 225 Y 9 39839402 A G splice site Het probably null 0.976 phenotype 04/17/2015
25 308925 UTSW Otud3 0.000 R3900 G1 198 Y 4 138896885 N282S T C missense Het probably benign 0.000 0.060 04/17/2015
26 308946 UTSW Prkar1a 1.000 R3900 G1 225 Y 11 109661075 K130R A G missense Het probably benign 0.292 0.071 phenotype 04/17/2015
27 308916 UTSW Rd3 0.000 R3900 G1 225 Y 1 191985256 V114A T C missense Het probably damaging 0.998 0.339 phenotype 04/17/2015
28 308955 UTSW Rictor 1.000 R3900 G1 225 Y 15 6789473 D1392E T G missense Het probably benign 0.010 0.060 phenotype 04/17/2015
29 308941 UTSW Setd2 0.959 R3900 G1 225 Y 9 110592518 R273W C T missense Het probably damaging 1.000 0.647 phenotype 04/17/2015
30 308934 UTSW Slc22a18 0.073 R3900 G1 145 Y 7 143479770 A86E C A missense Het probably damaging 0.995 0.647 phenotype 04/17/2015
31 308938 UTSW Slc24a1 0.117 R3900 G1 147 Y 9 64928144 S900R A T missense Het probably damaging 0.989 0.647 phenotype 04/17/2015
32 308940 UTSW Smarcc1 1.000 R3900 G1 225 Y 9 110118518 T C unclassified Het probably benign 0.090 phenotype 04/17/2015
33 308950 UTSW Smoc1 1.000 R3900 G1 225 Y 12 81167513 V234A T C missense Het probably damaging 0.976 0.062 phenotype 04/17/2015
34 308921 UTSW Stard9 0.195 R3900 G1 225 Y 2 120713549 T4443A A G missense Het possibly damaging 0.929 0.097 04/17/2015
35 308949 UTSW Timp2 0.000 R3900 G1 225 Y 11 118303716 D139N C T missense Het probably damaging 0.993 0.121 phenotype 04/17/2015
36 308922 UTSW Trim69 0.060 R3900 G1 225 Y 2 122178841 T461A A G missense Het probably benign 0.030 0.286 phenotype 04/17/2015
37 308937 UTSW Ubash3b 0.234 R3900 G1 225 Y 9 41031564 D211N C T missense Het probably benign 0.002 0.100 phenotype 04/17/2015
38 308926 UTSW Ubr4 1.000 R3900 G1 225 Y 4 139479062 T C critical splice donor site 2 bp Het probably null 0.959 phenotype 04/17/2015
39 308956 UTSW Ubr5 1.000 R3900 G1 225 Y 15 38019242 D752G T C missense Het probably damaging 0.999 0.770 phenotype 04/17/2015
40 308958 UTSW Urb1 1.000 R3900 G1 225 Y 16 90783376 I633N A T missense Het possibly damaging 0.858 0.196 04/17/2015
41 308948 UTSW Usp36 0.930 R3900 G1 225 Y 11 118279824 D28V T A missense Het possibly damaging 0.899 0.447 phenotype 04/17/2015
42 308939 UTSW Wdr6 0.336 R3900 G1 225 Y 9 108575769 A305V G A missense Het probably damaging 0.999 0.168 phenotype 04/17/2015
43 308930 UTSW Zfp248 0.073 R3900 G1 225 Y 6 118429566 N253S T C missense Het probably damaging 0.999 0.383 04/17/2015
[records 1 to 43 of 43]