Incidental Mutations

65 incidental mutations are currently displayed, and affect 65 genes.
14 are Possibly Damaging.
21 are Probably Damaging.
22 are Probably Benign.
8 are Probably Null.
2 create premature stop codons.
5 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 65 of 65] per page Full List
ID question?
Source question?
Gene question?
E-score question?
Stock # question?
Gen question?
Vld question?
Strain question?
Chr question?
Position question?
Mutation question?
Type question?
Exon Dist question?
Zygosity question?
Predicted Effect question?
PPH Score question?
Meta Score question?
MGI Phenotype question?
Posted question?
1 309723 UTSW 4932414N04Rik 0.000 R3916 G1 225 N 2 68731985 F319V T G missense Het possibly damaging 0.711 04/17/2015
2 309732 UTSW Acad12 0.075 R3916 G1 225 N 5 121599214 V498A A G missense Het probably damaging 0.998 0.804 04/17/2015
3 309762 UTSW Adam19 1.000 R3916 G1 225 N 11 46060935 E37G A G missense Het probably benign 0.252 0.083 phenotype 04/17/2015
4 309778 UTSW Anks3 1.000 R3916 G1 225 N 16 4947279 Y423H A G missense Het probably damaging 0.968 04/17/2015
5 309717 UTSW Arfgef1 1.000 R3916 G1 225 N 1 10189443 V600D A T missense Het probably benign 0.007 phenotype 04/17/2015
6 309741 UTSW Arhgef18 1.000 R3916 G1 225 N 8 3454197 F939L T C missense Het probably benign 0.000 phenotype 04/17/2015
7 309728 UTSW Arhgef2 0.454 R3916 G1 225 N 3 88633033 N127S A G missense Het probably damaging 1.000 phenotype 04/17/2015
8 309780 UTSW Arid1b 0.687 R3916 G1 225 N 17 5342653 S2100G A G missense Het probably benign 0.246 phenotype 04/17/2015
9 309763 UTSW Atp1b2 0.917 R3916 G1 225 N 11 69603075 V93A A G missense Het probably damaging 0.989 0.515 phenotype 04/17/2015
10 309785 UTSW Atrnl1 0.267 R3916 G1 225 N 19 57935652 V1283A T C missense Het possibly damaging 0.819 phenotype 04/17/2015
11 309726 UTSW Bpifb5 0.000 R3916 G1 225 N 2 154228181 K184Q A C missense Het probably benign 0.000 04/17/2015
12 309772 UTSW Cadps 1.000 R3916 G1 225 N 14 12457702 A1060T C T missense Het probably benign 0.003 0.060 phenotype 04/17/2015
13 309767 UTSW Cant1 0.088 R3916 G1 225 N 11 118408746 V259A A G missense Het probably damaging 0.984 phenotype 04/17/2015
14 309738 UTSW Ccdc89 0.242 R3916 G1 225 N 7 90426825 D81G A G missense Het probably damaging 1.000 0.304 04/17/2015
15 309751 UTSW Cd109 0.000 R3916 G1 217 N 9 78712500 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT critical splice acceptor site Het probably benign 0.090 phenotype 04/17/2015
16 309748 UTSW Cntnap4 0.110 R3916 G1 225 N 8 112875533 P1190A C G missense Het probably benign 0.023 0.091 phenotype 04/17/2015
17 309719 UTSW Colgalt2 0.078 R3916 G1 225 N 1 152508611 Y567* T A nonsense Het probably null 0.976 04/17/2015
18 309744 UTSW Cyp4f18 0.000 R3916 G1 225 N 8 71996037 F256Y A T missense Het probably benign 0.026 phenotype 04/17/2015
19 309769 UTSW Ddx41 1.000 R3916 G1 225 N 13 55534480 R205W G A missense Het possibly damaging 0.868 0.179 phenotype 04/17/2015
20 309752 UTSW Dopey1 0.418 R3916 G1 225 N 9 86521133 R1462H G A missense Het probably damaging 0.999 0.242 04/17/2015
21 309724 UTSW Dync1i2 0.969 R3916 G1 225 N 2 71249372 T377A A G missense Het probably damaging 0.999 phenotype 04/17/2015
22 309725 UTSW F2 1.000 R3916 G1 225 N 2 91625488 T600M G A missense Het probably damaging 1.000 phenotype 04/17/2015
23 309775 UTSW Fam91a1 0.000 R3916 G1 225 N 15 58430734 H308Y C T missense Het probably damaging 0.999 phenotype 04/17/2015
24 309783 UTSW Fkbp2 R3916 G1 225 N 19 6978557 C A critical splice donor site 1 bp Het probably null phenotype 04/17/2015
25 309747 UTSW Gabarapl2 1.000 R3916 G1 173 N 8 111952396 F115L T A missense Het probably benign 0.055 0.281 04/17/2015
26 309746 UTSW Heatr3 0.922 R3916 G1 225 N 8 88150371 T G critical splice donor site 2 bp Het probably null 0.949 phenotype 04/17/2015
27 309720 UTSW Ifi204 0.137 R3916 G1 225 N 1 173755775 K292N T G missense Het possibly damaging 0.946 04/17/2015
28 309737 UTSW Itpkc 0.358 R3916 G1 192 N 7 27228303 I62N A T missense Het probably benign 0.094 phenotype 04/17/2015
29 309727 UTSW Kcnab1 0.097 R3916 G1 217 N 3 65304164 G A critical splice donor site 1 bp Het probably null phenotype 04/17/2015
30 309777 UTSW Krt88 0.000 R3916 G1 225 N 15 101452928 G A splice site 5 bp Het probably null 0.976 04/17/2015
31 309776 UTSW Larp4 0.465 R3916 G1 225 N 15 99990403 T107I C T missense Het probably benign 0.001 04/17/2015
32 309774 UTSW Lmo7 0.184 R3916 G1 225 N 14 101929342 T C utr 3 prime Het probably benign phenotype 04/17/2015
33 309766 UTSW Lrrc37a 0.111 R3916 G1 225 N 11 103455518 Y3174C T C missense Het possibly damaging 0.834 04/17/2015
34 309757 UTSW Lyzl4 0.050 R3916 G1 225 N 9 121583035 D105V T A missense Het probably damaging 0.995 0.647 phenotype 04/17/2015
35 309756 UTSW Mst1 0.000 R3916 G1 225 N 9 108084295 I575V A G missense Het probably benign 0.002 0.090 phenotype 04/17/2015
36 309773 UTSW Myh7 0.883 R3916 G1 225 N 14 54974046 E1555D C A missense Het probably damaging 0.974 phenotype 04/17/2015
37 309745 UTSW Nwd1 0.150 R3916 G1 225 N 8 72667811 C608* T A nonsense Het probably null 0.976 phenotype 04/17/2015
38 309736 UTSW Obox3 0.145 R3916 G1 225 N 7 15627226 C38F C A missense Het probably benign 0.001 04/17/2015
39 474559 UTSW P4ha2 0.495 R3916 G1 225 N 11 54126248 D441G A G missense Het probably benign 0.066 phenotype 04/14/2017
40 309782 UTSW Pcdhb14 0.151 R3916 G1 225 N 18 37448545 I235F A T missense Het possibly damaging 0.481 04/17/2015
41 309771 UTSW Rasgrf2 0.171 R3916 G1 225 N 13 92030788 V259A A G missense Het probably damaging 0.999 phenotype 04/17/2015
42 309721 UTSW Scn1a 1.000 R3916 G1 225 N 2 66277613 T1590A T C missense Het probably damaging 0.995 phenotype 04/17/2015
43 309734 UTSW Sdk1 0.086 R3916 G1 225 N 5 142051244 D817E T A missense Het probably damaging 0.981 0.647 phenotype 04/17/2015
44 309755 UTSW Sema3b 0.295 R3916 G1 225 N 9 107600458 F482S A G missense Het probably damaging 1.000 phenotype 04/17/2015
45 474562 UTSW Slc35a5 0.123 R3916 G1 222 N 16 45158158 G C intron Het probably benign phenotype 04/14/2017
46 309770 UTSW Slc6a3 0.000 R3916 G1 225 N 13 73562308 I346V A G missense Het probably benign 0.003 phenotype 04/17/2015
47 309761 UTSW Slu7 1.000 R3916 G1 225 N 11 43440684 G T splice site 5 bp Het probably null 0.976 phenotype 04/17/2015
48 309740 UTSW Spns1 1.000 R3916 G1 225 N 7 126371539 A T critical splice donor site 2 bp Het probably null phenotype 04/17/2015
49 309758 UTSW Supv3l1 1.000 R3916 G1 152 N 10 62449420 D89G T C missense Het possibly damaging 0.665 phenotype 04/17/2015
50 309749 UTSW Taf1c 0.954 R3916 G1 121 N 8 119600505 R412W G A missense Het probably damaging 1.000 phenotype 04/17/2015
51 309784 UTSW Tctn3 1.000 R3916 G1 225 N 19 40607649 T305S T A missense Het possibly damaging 0.683 phenotype 04/17/2015
52 309764 UTSW Tekt1 0.174 R3916 G1 225 N 11 72345748 I296T A G missense Het possibly damaging 0.831 phenotype 04/17/2015
53 309729 UTSW Tet2 1.000 R3916 G1 225 N 3 133486055 K873E T C missense Het possibly damaging 0.528 phenotype 04/17/2015
54 309781 UTSW Thada 0.000 R3916 G1 225 N 17 84441782 A587V G A missense Het possibly damaging 0.921 phenotype 04/17/2015
55 309779 UTSW Tmprss15 0.000 R3916 G1 225 N 16 78985996 N712Y T A missense Het probably damaging 1.000 phenotype 04/17/2015
56 309743 UTSW Tnks 0.000 R3916 G1 225 N 8 34853361 S719P A G missense Het probably damaging 1.000 0.901 phenotype 04/17/2015
57 309739 UTSW Tnrc6a 0.858 R3916 G1 225 N 7 123181384 Q1332H A C missense Het probably damaging 0.997 phenotype 04/17/2015
58 309765 UTSW Trpv3 0.126 R3916 G1 225 N 11 73283734 D309G A G missense Het possibly damaging 0.866 0.474 phenotype 04/17/2015
59 309742 UTSW Tti2 1.000 R3916 G1 225 N 8 31153519 K221E A G missense Het possibly damaging 0.943 0.161 phenotype 04/17/2015
60 309754 UTSW Uba5 1.000 R3916 G1 225 N 9 104054190 C227S A T missense Het probably damaging 1.000 phenotype 04/17/2015
61 309730 UTSW Ugcg 1.000 R3916 G1 225 N 4 59207798 P46S C T missense Het probably benign 0.175 0.080 phenotype 04/17/2015
62 309718 UTSW Unc80 0.925 R3916 G1 225 N 1 66677495 C2925R T C missense Het probably benign 0.109 phenotype 04/17/2015
63 309759 UTSW Vmn2r83 0.096 R3916 G1 225 N 10 79478910 G331R G A missense Het probably benign 0.007 04/17/2015
64 309722 UTSW Xirp2 0.302 R3916 G1 225 N 2 67511422 V1336F G T missense Het probably benign 0.246 phenotype 04/17/2015
65 309733 UTSW Zbed5 0.000 R3916 G1 225 N 5 129902277 Y356H T C missense Het possibly damaging 0.915 0.179 phenotype 04/17/2015
[records 1 to 65 of 65]