Incidental Mutations

65 incidental mutations are currently displayed, and affect 65 genes.
14 are Possibly Damaging.
21 are Probably Damaging.
22 are Probably Benign.
8 are Probably Null.
2 create premature stop codons.
5 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 65 of 65] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 309723 UTSW 4932414N04Rik 0.000 R3916 G1 225 N 2 68731985 F319V T G missense Het possibly damaging 0.711 04/17/2015
2 309732 UTSW Acad12 0.065 R3916 G1 225 N 5 121599214 V498A A G missense Het probably damaging 0.998 0.804 04/17/2015
3 309762 UTSW Adam19 1.000 R3916 G1 225 N 11 46060935 E37G A G missense Het probably benign 0.252 0.083 phenotype 04/17/2015
4 309778 UTSW Anks3 1.000 R3916 G1 225 N 16 4947279 Y423H A G missense Het probably damaging 0.968 04/17/2015
5 309717 UTSW Arfgef1 1.000 R3916 G1 225 N 1 10189443 V600D A T missense Het probably benign 0.007 phenotype 04/17/2015
6 309741 UTSW Arhgef18 1.000 R3916 G1 225 N 8 3454197 F939L T C missense Het probably benign 0.000 phenotype 04/17/2015
7 309728 UTSW Arhgef2 0.520 R3916 G1 225 N 3 88633033 N127S A G missense Het probably damaging 1.000 phenotype 04/17/2015
8 309780 UTSW Arid1b 0.627 R3916 G1 225 N 17 5342653 S2100G A G missense Het probably benign 0.246 phenotype 04/17/2015
9 309763 UTSW Atp1b2 0.879 R3916 G1 225 N 11 69603075 V93A A G missense Het probably damaging 0.989 0.515 phenotype 04/17/2015
10 309785 UTSW Atrnl1 0.303 R3916 G1 225 N 19 57935652 V1283A T C missense Het possibly damaging 0.819 phenotype 04/17/2015
11 309726 UTSW Bpifb5 0.000 R3916 G1 225 N 2 154228181 K184Q A C missense Het probably benign 0.000 04/17/2015
12 309772 UTSW Cadps 1.000 R3916 G1 225 N 14 12457702 A1060T C T missense Het probably benign 0.003 0.060 phenotype 04/17/2015
13 309767 UTSW Cant1 0.108 R3916 G1 225 N 11 118408746 V259A A G missense Het probably damaging 0.984 phenotype 04/17/2015
14 309738 UTSW Ccdc89 0.169 R3916 G1 225 N 7 90426825 D81G A G missense Het probably damaging 1.000 0.304 04/17/2015
15 309751 UTSW Cd109 0.000 R3916 G1 217 N 9 78712500 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT critical splice acceptor site Het probably benign 0.090 phenotype 04/17/2015
16 309748 UTSW Cntnap4 0.070 R3916 G1 225 N 8 112875533 P1190A C G missense Het probably benign 0.023 0.091 phenotype 04/17/2015
17 309719 UTSW Colgalt2 0.076 R3916 G1 225 N 1 152508611 Y567* T A nonsense Het probably null 0.976 04/17/2015
18 309744 UTSW Cyp4f18 0.000 R3916 G1 225 N 8 71996037 F256Y A T missense Het probably benign 0.026 phenotype 04/17/2015
19 309769 UTSW Ddx41 1.000 R3916 G1 225 N 13 55534480 R205W G A missense Het possibly damaging 0.868 0.179 phenotype 04/17/2015
20 309752 UTSW Dopey1 0.192 R3916 G1 225 N 9 86521133 R1462H G A missense Het probably damaging 0.999 0.242 04/17/2015
21 309724 UTSW Dync1i2 0.970 R3916 G1 225 N 2 71249372 T377A A G missense Het probably damaging 0.999 phenotype 04/17/2015
22 309725 UTSW F2 1.000 R3916 G1 225 N 2 91625488 T600M G A missense Het probably damaging 1.000 phenotype 04/17/2015
23 309775 UTSW Fam91a1 0.000 R3916 G1 225 N 15 58430734 H308Y C T missense Het probably damaging 0.999 phenotype 04/17/2015
24 309783 UTSW Fkbp2 R3916 G1 225 N 19 6978557 C A critical splice donor site 1 bp Het probably null phenotype 04/17/2015
25 309747 UTSW Gabarapl2 1.000 R3916 G1 173 N 8 111952396 F115L T A missense Het probably benign 0.055 0.281 04/17/2015
26 309746 UTSW Heatr3 0.880 R3916 G1 225 N 8 88150371 T G critical splice donor site 2 bp Het probably null 0.949 phenotype 04/17/2015
27 309720 UTSW Ifi204 0.097 R3916 G1 225 N 1 173755775 K292N T G missense Het possibly damaging 0.946 04/17/2015
28 309737 UTSW Itpkc 0.456 R3916 G1 192 N 7 27228303 I62N A T missense Het probably benign 0.094 phenotype 04/17/2015
29 309727 UTSW Kcnab1 0.107 R3916 G1 217 N 3 65304164 G A critical splice donor site 1 bp Het probably null phenotype 04/17/2015
30 309777 UTSW Krt88 0.000 R3916 G1 225 N 15 101452928 G A splice site 5 bp Het probably null 0.976 04/17/2015
31 309776 UTSW Larp4 0.329 R3916 G1 225 N 15 99990403 T107I C T missense Het probably benign 0.001 04/17/2015
32 309774 UTSW Lmo7 0.337 R3916 G1 225 N 14 101929342 T C utr 3 prime Het probably benign phenotype 04/17/2015
33 309766 UTSW Lrrc37a 0.111 R3916 G1 225 N 11 103455518 Y3174C T C missense Het possibly damaging 0.834 04/17/2015
34 309757 UTSW Lyzl4 0.049 R3916 G1 225 N 9 121583035 D105V T A missense Het probably damaging 0.995 0.647 phenotype 04/17/2015
35 309756 UTSW Mst1 0.000 R3916 G1 225 N 9 108084295 I575V A G missense Het probably benign 0.002 0.090 phenotype 04/17/2015
36 309773 UTSW Myh7 0.883 R3916 G1 225 N 14 54974046 E1555D C A missense Het probably damaging 0.974 phenotype 04/17/2015
37 309745 UTSW Nwd1 0.159 R3916 G1 225 N 8 72667811 C608* T A nonsense Het probably null 0.976 phenotype 04/17/2015
38 309736 UTSW Obox3 0.249 R3916 G1 225 N 7 15627226 C38F C A missense Het probably benign 0.001 04/17/2015
39 474559 UTSW P4ha2 0.485 R3916 G1 225 N 11 54126248 D441G A G missense Het probably benign 0.066 phenotype 04/14/2017
40 309782 UTSW Pcdhb14 0.116 R3916 G1 225 N 18 37448545 I235F A T missense Het possibly damaging 0.481 04/17/2015
41 309771 UTSW Rasgrf2 0.178 R3916 G1 225 N 13 92030788 V259A A G missense Het probably damaging 0.999 phenotype 04/17/2015
42 309721 UTSW Scn1a 1.000 R3916 G1 225 N 2 66277613 T1590A T C missense Het probably damaging 0.995 phenotype 04/17/2015
43 309734 UTSW Sdk1 0.065 R3916 G1 225 N 5 142051244 D817E T A missense Het probably damaging 0.981 0.647 phenotype 04/17/2015
44 309755 UTSW Sema3b 0.288 R3916 G1 225 N 9 107600458 F482S A G missense Het probably damaging 1.000 phenotype 04/17/2015
45 474562 UTSW Slc35a5 0.172 R3916 G1 222 N 16 45158158 G C intron Het probably benign phenotype 04/14/2017
46 309770 UTSW Slc6a3 0.000 R3916 G1 225 N 13 73562308 I346V A G missense Het probably benign 0.003 phenotype 04/17/2015
47 309761 UTSW Slu7 1.000 R3916 G1 225 N 11 43440684 G T splice site 5 bp Het probably null 0.976 phenotype 04/17/2015
48 309740 UTSW Spns1 1.000 R3916 G1 225 N 7 126371539 A T critical splice donor site 2 bp Het probably null phenotype 04/17/2015
49 309758 UTSW Supv3l1 1.000 R3916 G1 152 N 10 62449420 D89G T C missense Het possibly damaging 0.665 phenotype 04/17/2015
50 309749 UTSW Taf1c 0.918 R3916 G1 121 N 8 119600505 R412W G A missense Het probably damaging 1.000 phenotype 04/17/2015
51 309784 UTSW Tctn3 1.000 R3916 G1 225 N 19 40607649 T305S T A missense Het possibly damaging 0.683 phenotype 04/17/2015
52 309764 UTSW Tekt1 0.151 R3916 G1 225 N 11 72345748 I296T A G missense Het possibly damaging 0.831 phenotype 04/17/2015
53 309729 UTSW Tet2 1.000 R3916 G1 225 N 3 133486055 K873E T C missense Het possibly damaging 0.528 phenotype 04/17/2015
54 309781 UTSW Thada 0.000 R3916 G1 225 N 17 84441782 A587V G A missense Het possibly damaging 0.921 phenotype 04/17/2015
55 309779 UTSW Tmprss15 0.000 R3916 G1 225 N 16 78985996 N712Y T A missense Het probably damaging 1.000 phenotype 04/17/2015
56 309743 UTSW Tnks 0.000 R3916 G1 225 N 8 34853361 S719P A G missense Het probably damaging 1.000 0.901 phenotype 04/17/2015
57 309739 UTSW Tnrc6a 0.805 R3916 G1 225 N 7 123181384 Q1332H A C missense Het probably damaging 0.997 phenotype 04/17/2015
58 309765 UTSW Trpv3 0.109 R3916 G1 225 N 11 73283734 D309G A G missense Het possibly damaging 0.866 0.474 phenotype 04/17/2015
59 309742 UTSW Tti2 1.000 R3916 G1 225 N 8 31153519 K221E A G missense Het possibly damaging 0.943 0.161 phenotype 04/17/2015
60 309754 UTSW Uba5 1.000 R3916 G1 225 N 9 104054190 C227S A T missense Het probably damaging 1.000 phenotype 04/17/2015
61 309730 UTSW Ugcg 1.000 R3916 G1 225 N 4 59207798 P46S C T missense Het probably benign 0.175 0.080 phenotype 04/17/2015
62 309718 UTSW Unc80 0.908 R3916 G1 225 N 1 66677495 C2925R T C missense Het probably benign 0.109 phenotype 04/17/2015
63 309759 UTSW Vmn2r83 0.098 R3916 G1 225 N 10 79478910 G331R G A missense Het probably benign 0.007 04/17/2015
64 309722 UTSW Xirp2 0.396 R3916 G1 225 N 2 67511422 V1336F G T missense Het probably benign 0.246 phenotype 04/17/2015
65 309733 UTSW Zbed5 0.000 R3916 G1 225 N 5 129902277 Y356H T C missense Het possibly damaging 0.915 0.179 phenotype 04/17/2015
[records 1 to 65 of 65]