Incidental Mutations

75 incidental mutations are currently displayed, and affect 75 genes.
7 are Possibly Damaging.
25 are Probably Damaging.
28 are Probably Benign.
12 are Probably Null.
4 create premature stop codons.
5 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 75 of 75] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 307332 UTSW Acad12 0.062 R3917 G1 225 Y 5 121599214 V498A A G missense Het probably damaging 0.998 0.804 04/17/2015
2 307363 UTSW Adam19 1.000 R3917 G1 225 Y 11 46060935 E37G A G missense Het probably benign 0.252 0.083 phenotype 04/17/2015
3 307380 UTSW Apol11b 0.050 R3917 G1 225 Y 15 77635304 I192T A G missense Het probably benign 0.025 0.090 04/17/2015
4 307377 UTSW Appl1 0.160 R3917 G1 225 Y 14 26928604 F537Y A T missense Het probably damaging 1.000 0.304 phenotype 04/17/2015
5 307369 UTSW Atad5 1.000 R3917 G1 225 Y 11 80103294 K785N A C missense Het probably null 0.966 0.976 phenotype 04/17/2015
6 307366 UTSW Atp1b2 0.917 R3917 G1 225 Y 11 69603075 V93A A G missense Het probably damaging 0.989 0.515 phenotype 04/17/2015
7 307343 UTSW Bcam 0.000 R3917 G1 225 Y 7 19765450 Y216C T C missense Het probably damaging 1.000 0.628 phenotype 04/17/2015
8 307337 UTSW Brca2 1.000 R3917 G1 225 Y 5 150540827 E1352G A G missense Het probably damaging 0.961 0.117 phenotype 04/17/2015
9 307360 UTSW C030005K15Rik 0.058 R3917 G1 225 Y 10 97725591 S93A A C missense Het unknown 0.087 04/17/2015
10 307376 UTSW Cadps 1.000 R3917 G1 225 Y 14 12457702 A1060T C T missense Het probably benign 0.003 0.060 phenotype 04/17/2015
11 307375 UTSW Ccdc88c 0.000 R3917 G1 225 Y 12 100941107 A G critical splice donor site 2 bp Het probably null 0.958 phenotype 04/17/2015
12 307346 UTSW Ccdc89 0.223 R3917 G1 225 Y 7 90426825 D81G A G missense Het probably damaging 1.000 0.304 04/17/2015
13 307382 UTSW Ccnt1 0.937 R3917 G1 225 Y 15 98544059 S443P A G missense Het probably benign 0.002 0.068 phenotype 04/17/2015
14 307356 UTSW Cd109 0.000 R3917 G1 217 Y 9 78712500 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT critical splice acceptor site Het probably benign 0.090 phenotype 04/17/2015
15 307321 UTSW Cdc42bpa 0.473 R3917 G1 225 Y 1 180106154 T C critical splice donor site 2 bp Het probably null 0.949 phenotype 04/17/2015
16 307330 UTSW Cdk11b 1.000 R3917 G1 225 Y 4 155626801 S47P T C missense Het probably damaging 0.997 0.136 phenotype 04/17/2015
17 307391 UTSW Cfap43 0.136 R3917 G1 225 Y 19 47897750 D142G T C missense Het probably benign 0.002 0.090 phenotype 04/17/2015
18 307352 UTSW Cntnap4 0.102 R3917 G1 165 Y 8 112875533 P1190A C G missense Het probably benign 0.023 0.091 phenotype 04/17/2015
19 307319 UTSW Colgalt2 0.063 R3917 G1 225 Y 1 152508611 Y567* T A nonsense Het probably null 0.976 04/17/2015
20 307318 UTSW Dner 0.000 R3917 G1 108 Y 1 84585549 CGCTGCTGCTGCTGCTGCTGCTGCTGC CGCTGCTGCTGCTGCTGCTGCTGC utr 5 prime Het probably benign phenotype 04/17/2015
21 307327 UTSW Dock7 0.000 R3917 G1 225 Y 4 99016685 Y651C T C missense Het probably damaging 1.000 0.220 phenotype 04/17/2015
22 307378 UTSW Fzd3 1.000 R3917 G1 225 Y 14 65235930 F130I A T missense Het probably damaging 0.967 0.581 phenotype 04/17/2015
23 307351 UTSW Gabarapl2 1.000 R3917 G1 225 Y 8 111952396 F115L T A missense Het probably benign 0.055 0.281 04/17/2015
24 307331 UTSW Gm1043 0.054 R3917 G1 225 Y 5 37192941 G A intron Het probably benign 04/17/2015
25 307364 UTSW Gm12185 0.075 R3917 G1 225 Y 11 48915933 F144L A G missense Het probably benign 0.010 0.286 04/17/2015
26 307323 UTSW Gm14124 0.072 R3917 G1 225 Y 2 150266119 T A splice site Het probably benign 04/17/2015
27 307379 UTSW Gm21961 0.081 R3917 G1 225 Y 15 65014884 D7E A T missense Het unknown 0.087 04/17/2015
28 307336 UTSW Gtf3a 0.933 R3917 G1 225 Y 5 146955434 K332E A G missense Het probably benign 0.262 0.208 phenotype 04/17/2015
29 307387 UTSW Haao 0.000 R3917 G1 225 Y 17 83838799 A G critical splice donor site 2 bp Het probably null 0.959 phenotype 04/17/2015
30 307393 UTSW Habp2 0.068 R3917 G1 225 Y 19 56311179 C170S T A missense Het probably damaging 1.000 0.969 phenotype 04/17/2015
31 307350 UTSW Heatr3 0.940 R3917 G1 225 Y 8 88150371 T G critical splice donor site 2 bp Het probably null 0.949 phenotype 04/17/2015
32 307355 UTSW Herc1 0.000 R3917 G1 225 Y 9 66434466 C1846G T G missense Het possibly damaging 0.942 0.448 phenotype 04/17/2015
33 307328 UTSW Hivep3 0.000 R3917 G1 225 Y 4 120099427 S1647P T C missense Het probably benign 0.268 0.101 phenotype 04/17/2015
34 307344 UTSW Hnrnpul1 0.638 R3917 G1 225 Y 7 25726875 R517Q C T missense Het probably damaging 0.999 0.685 phenotype 04/17/2015
35 307329 UTSW Hspg2 1.000 R3917 G1 129 Y 4 137559314 E3648G A G missense Het probably damaging 1.000 0.456 phenotype 04/17/2015
36 307354 UTSW Jaml 0.054 R3917 G1 225 Y 9 45101151 T C unclassified Het probably benign 0.090 04/17/2015
37 359673 UTSW Jund 0.881 R3917 G1 53.1 Y 8 70699023 C T unclassified Het probably benign phenotype 11/13/2015
38 307339 UTSW Klra14-ps 0.153 R3917 G1 225 Y 6 130157632 T C splice site Het noncoding transcript 04/17/2015
39 307383 UTSW Krt88 0.000 R3917 G1 225 Y 15 101452928 G A splice site 5 bp Het probably null 0.976 04/17/2015
40 307389 UTSW Lrp5 0.887 R3917 G1 225 Y 19 3612330 R173C G A missense Het probably damaging 1.000 0.883 phenotype 04/17/2015
41 307359 UTSW Lyzl4 0.051 R3917 G1 225 Y 9 121583035 D105V T A missense Het probably damaging 0.995 0.647 phenotype 04/17/2015
42 307358 UTSW Mst1 0.000 R3917 G1 225 Y 9 108084295 I575V A G missense Het probably benign 0.002 0.090 phenotype 04/17/2015
43 474744 UTSW Myd88 0.000 R3917 G1 225 N 9 119341398 T C utr 5 prime Het probably benign phenotype 04/14/2017
44 307370 UTSW Myo1d 0.000 R3917 G1 225 Y 11 80666578 V512E A T missense Het probably damaging 1.000 0.975 04/17/2015
45 307390 UTSW Ndufv1 1.000 R3917 G1 225 Y 19 4010002 Y33H A G missense Het probably damaging 1.000 0.945 phenotype 04/17/2015
46 307349 UTSW Nwd1 0.151 R3917 G1 225 Y 8 72667811 C608* T A nonsense Het probably null 0.976 phenotype 04/17/2015
47 307385 UTSW Olfr118 0.077 R3917 G1 225 Y 17 37672793 F257I T A missense Het probably damaging 1.000 0.507 phenotype 04/17/2015
48 307353 UTSW Olfr884 0.087 R3917 G1 225 Y 9 38047545 I108F A T missense Het probably damaging 1.000 0.514 phenotype 04/17/2015
49 307326 UTSW Patj 0.000 R3917 G1 225 Y 4 98592008 K1317* A T nonsense Het probably null 0.975 phenotype 04/17/2015
50 307320 UTSW Pld5 0.000 R3917 G1 225 Y 1 175963938 S501P A G missense Het probably benign 0.003 0.090 phenotype 04/17/2015
51 307372 UTSW Pnpo 0.557 R3917 G1 225 Y 11 96939757 V146A A G missense Het probably damaging 0.997 0.361 phenotype 04/17/2015
52 307324 UTSW Ppdpf 0.000 R3917 G1 207 Y 2 181187728 Y16C A G missense Het probably benign 0.191 0.301 04/17/2015
53 307373 UTSW Ppp1r27 0.155 R3917 G1 225 Y 11 120550959 V32A A G missense Het possibly damaging 0.890 0.114 04/17/2015
54 307338 UTSW Rbm28 0.945 R3917 G1 225 Y 6 29154789 D294G T C missense Het probably benign 0.004 0.090 phenotype 04/17/2015
55 307335 UTSW Sdk1 0.071 R3917 G1 225 Y 5 142051244 D817E T A missense Het probably damaging 0.981 0.647 phenotype 04/17/2015
56 307381 UTSW Shank3 0.282 R3917 G1 225 Y 15 89503384 D252G A G missense Het possibly damaging 0.768 0.246 phenotype 04/17/2015
57 307386 UTSW Slc29a1 0.000 R3917 G1 225 Y 17 45588973 A T splice site 799 bp Het probably null 0.976 phenotype 04/17/2015
58 474746 UTSW Slc35a5 0.149 R3917 G1 183 N 16 45158158 G C intron Het probably benign phenotype 04/14/2017
59 307345 UTSW Slc6a5 1.000 R3917 G1 225 Y 7 49911869 S50P T C missense Het probably damaging 1.000 0.103 phenotype 04/17/2015
60 307371 UTSW Slfn8 0.096 R3917 G1 225 Y 11 83016993 Y241* A T nonsense Het probably null 0.971 04/17/2015
61 307362 UTSW Slu7 1.000 R3917 G1 225 Y 11 43440684 G T splice site 5 bp Het probably null 0.976 phenotype 04/17/2015
62 307388 UTSW Smad2 1.000 R3917 G1 225 Y 18 76287937 D82E T A missense Het probably benign 0.417 0.523 phenotype 04/17/2015
63 307340 UTSW Spx 0.000 R3917 G1 225 Y 6 142414031 E33A A C missense Het probably damaging 0.989 0.077 phenotype 04/17/2015
64 307374 UTSW Tdp1 0.196 R3917 G1 225 Y 12 99894717 Y205C A G missense Het probably damaging 1.000 0.925 phenotype 04/17/2015
65 307367 UTSW Tekt1 0.177 R3917 G1 225 N 11 72345748 I296T A G missense Het possibly damaging 0.831 phenotype 04/17/2015
66 359674 UTSW Tgm1 0.925 R3917 G1 99 Y 14 55712757 G A splice site Het probably benign 0.090 phenotype 11/13/2015
67 307348 UTSW Tnks 0.000 R3917 G1 225 Y 8 34853361 S719P A G missense Het probably damaging 1.000 0.901 phenotype 04/17/2015
68 307334 UTSW Trip6 0.000 R3917 G1 225 Y 5 137313679 C47R A G missense Het probably benign 0.403 0.095 phenotype 04/17/2015
69 307368 UTSW Trpv3 0.074 R3917 G1 225 Y 11 73283734 D309G A G missense Het possibly damaging 0.866 0.474 phenotype 04/17/2015
70 307347 UTSW Tti2 1.000 R3917 G1 225 Y 8 31153519 K221E A G missense Het possibly damaging 0.943 0.161 phenotype 04/17/2015
71 307325 UTSW Ugcg 1.000 R3917 G1 225 Y 4 59207798 P46S C T missense Het probably benign 0.175 0.080 phenotype 04/17/2015
72 307342 UTSW Vmn1r57 0.055 R3917 G1 225 Y 7 5220631 N52Y A T missense Het probably damaging 1.000 0.647 04/17/2015
73 307384 UTSW Vmn2r94 0.102 R3917 G1 225 Y 17 18244358 F557L A G missense Het probably benign 0.000 0.090 04/17/2015
74 307333 UTSW Zbed5 0.000 R3917 G1 225 Y 5 129902277 Y356H T C missense Het possibly damaging 0.915 0.179 phenotype 04/17/2015
75 307357 UTSW Zic4 0.217 R3917 G1 225 Y 9 91384341 C A splice site Het probably benign 0.090 phenotype 04/17/2015
[records 1 to 75 of 75]