Incidental Mutations

34 incidental mutations are currently displayed, and affect 34 genes.
4 are Possibly Damaging.
13 are Probably Damaging.
12 are Probably Benign.
4 are Probably Null.
1 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 34 of 34] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 307762 UTSW Acin1 0.943 R3947 G1 225 Y 14 54679333 Q133L T A missense Het possibly damaging 0.889 0.102 phenotype 04/17/2015
2 307771 UTSW Adgrg4 0.072 R3947 G1 222 Y X 56917754 T1561I C T missense Het probably benign 0.246 0.107 phenotype 04/17/2015
3 307747 UTSW Avl9 0.129 R3947 G1 225 Y 6 56728665 T C critical splice donor site 2 bp Het probably null 0.950 04/17/2015
4 307748 UTSW C87436 0.314 R3947 G1 225 Y 6 86446186 H247Q T A missense Het probably damaging 1.000 0.843 04/17/2015
5 307769 UTSW Cfap43 0.134 R3947 G1 225 Y 19 47765979 H969N G T missense Het probably benign 0.282 0.090 phenotype 04/17/2015
6 307752 UTSW Chst15 0.064 R3947 G1 225 Y 7 132247875 N446Y T A missense Het probably damaging 1.000 0.289 phenotype 04/17/2015
7 307739 UTSW Col4a3 0.000 R3947 G1 225 Y 1 82715332 I1446N T A missense Het probably damaging 0.996 0.647 phenotype 04/17/2015
8 307755 UTSW Disc1 0.429 R3947 G1 181 Y 8 125088135 E246G A G missense Het probably damaging 1.000 0.108 phenotype 04/17/2015
9 307751 UTSW Dyrk4 0.000 R3947 G1 225 Y 6 126885305 I408T A G missense Het probably damaging 1.000 0.734 phenotype 04/17/2015
10 307743 UTSW Fnbp1l 0.000 R3947 G1 225 Y 3 122544579 A481D G T missense Het possibly damaging 0.778 0.106 04/17/2015
11 307757 UTSW Gm10608 0.082 R3947 G1 128 N 9 119160662 TACACACACACACACACACACACACACACACACACACACACACACACACACACACA TACACACACACACACACACACACACACACACACACACACACACACACACA small deletion Het probably benign 04/17/2015
12 307768 UTSW Grk2 1.000 R3947 G1 225 Y 19 4292417 T129M G A missense Het possibly damaging 0.953 0.179 phenotype 04/17/2015
13 307738 UTSW Ino80d 1.000 R3947 G1 225 Y 1 63074503 Q263K G T missense Het probably benign 0.164 0.083 04/17/2015
14 307750 UTSW Iqsec3 0.000 R3947 G1 225 Y 6 121387824 Y835* A T nonsense Het probably null 0.975 04/17/2015
15 307758 UTSW Irak3 0.364 R3947 G1 225 Y 10 120170373 M213L T A missense Het probably benign 0.003 0.063 phenotype 04/17/2015
16 307744 UTSW Macf1 1.000 R3947 G1 225 Y 4 123380420 R6388G T C missense Het probably damaging 1.000 0.757 phenotype 04/17/2015
17 307754 UTSW Mtnr1a 0.000 R3947 G1 225 Y 8 45087520 Y173H T C missense Het probably damaging 1.000 0.553 phenotype 04/17/2015
18 307767 UTSW Myo5b 0.733 R3947 G1 225 Y 18 74695403 R709W C T missense Het probably damaging 1.000 0.157 phenotype 04/17/2015
19 307740 UTSW Nebl 0.000 R3947 G1 225 Y 2 17378106 A T critical splice donor site 2 bp Het probably null 0.949 04/17/2015
20 307759 UTSW Obscn 0.633 R3947 G1 218 Y 11 59131646 R758G T C missense Het possibly damaging 0.896 0.179 phenotype 04/17/2015
21 307766 UTSW Olfr123 0.062 R3947 G1 225 Y 17 37796115 I224L A T missense Het probably benign 0.000 0.090 phenotype 04/17/2015
22 307753 UTSW Pex11g 0.000 R3947 G1 225 Y 8 3465787 T82I G A missense Het probably benign 0.213 0.090 phenotype 04/17/2015
23 307756 UTSW Pgr 0.239 R3947 G1 225 Y 9 8961452 I842V A G missense Het probably benign 0.246 phenotype 04/17/2015
24 307765 UTSW Pkd1 1.000 R3947 G1 225 Y 17 24578037 T A splice site Het probably benign 0.090 phenotype 04/17/2015
25 307770 UTSW Rbm20 0.135 R3947 G1 225 Y 19 53813337 I92T T C missense Het probably benign 0.349 0.090 phenotype 04/17/2015
26 307742 UTSW Ryr3 0.513 R3947 G1 225 Y 2 112675873 R3443P C G missense Het probably damaging 0.993 0.579 phenotype 04/17/2015
27 307760 UTSW Ssh2 0.282 R3947 G1 225 Y 11 77398256 D88G A G missense Het probably damaging 0.989 0.884 phenotype 04/17/2015
28 307749 UTSW Suclg2 0.000 R3947 G1 225 Y 6 95579238 G T splice site Het probably null 0.976 phenotype 04/17/2015
29 307763 UTSW Tdrd3 0.269 R3947 G1 225 Y 14 87506599 D655V A T missense Het probably damaging 1.000 0.917 phenotype 04/17/2015
30 307761 UTSW Tex2 0.000 R3947 G1 225 Y 11 106520003 D896N C T missense Het unknown 0.254 04/17/2015
31 307746 UTSW Tmem168 0.088 R3947 G1 225 Y 6 13583052 R610L C A missense Het probably damaging 0.999 0.773 04/17/2015
32 307741 UTSW Ttc17 0.739 R3947 G1 225 Y 2 94376146 A G splice site Het probably benign 0.090 04/17/2015
33 307764 UTSW Vmn2r99 0.127 R3947 G1 225 N 17 19378990 M312T T C missense Het probably benign 0.403 0.090 04/17/2015
34 307745 UTSW Wdfy3 0.929 R3947 G1 225 Y 5 101870036 E2546G T C missense Het probably damaging 0.999 0.238 phenotype 04/17/2015
[records 1 to 34 of 34]