Incidental Mutations

57 incidental mutations are currently displayed, and affect 57 genes.
14 are Possibly Damaging.
17 are Probably Damaging.
24 are Probably Benign.
2 are Probably Null.
1 create premature stop codons.
0 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 57 of 57] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 313413 UTSW Actn1 0.358 R4024 G1 142 Y 12 80168477 Y842H A G missense Het probably damaging 1.000 0.710 phenotype 04/30/2015
2 313393 UTSW Adamts9 1.000 R4024 G1 225 Y 6 92872784 A G splice site Het probably benign 0.090 phenotype 04/30/2015
3 313424 UTSW Adgrg7 0.000 R4024 G1 225 Y 16 56730298 Y684N A T missense Het probably damaging 1.000 0.722 phenotype 04/30/2015
4 313390 UTSW Aoc1 0.000 R4024 G1 225 Y 6 48908269 N646I A T missense Het probably damaging 1.000 0.834 phenotype 04/30/2015
5 313409 UTSW Armc2 1.000 R4024 G1 225 Y 10 41993058 S37P A G missense Het probably benign 0.000 0.071 04/30/2015
6 313418 UTSW Bhmt2 0.125 R4024 G1 225 Y 13 93663331 G A splice site Het probably benign phenotype 04/30/2015
7 313378 UTSW Bpifb1 0.000 R4024 G1 225 Y 2 154213046 D286V A T missense Het probably damaging 1.000 0.290 phenotype 04/30/2015
8 313419 UTSW Cadps 1.000 R4024 G1 225 Y 14 12705539 E285D T A missense Het probably damaging 0.999 0.106 phenotype 04/30/2015
9 313416 UTSW Cap2 0.106 R4024 G1 225 Y 13 46637841 C T splice site Het probably benign phenotype 04/30/2015
10 313394 UTSW Clcn4 0.000 R4024 G1 126 Y 7 7290428 Y443S T G missense Het probably damaging 1.000 0.970 phenotype 04/30/2015
11 313386 UTSW Clcn6 0.103 R4024 G1 197 Y 4 148014283 T463S T A missense Het possibly damaging 0.909 0.145 phenotype 04/30/2015
12 313399 UTSW Cmip 1.000 R4024 G1 225 Y 8 117447416 I412V A G missense Het possibly damaging 0.787 0.087 phenotype 04/30/2015
13 313426 UTSW Cndp1 0.130 R4024 G1 225 Y 18 84628813 D250G T C missense Het probably damaging 0.999 0.600 phenotype 04/30/2015
14 313422 UTSW Colec10 0.000 R4024 G1 225 Y 15 54462551 D259G A G missense Het probably damaging 0.998 0.873 phenotype 04/30/2015
15 313392 UTSW Ctnna2 0.885 R4024 G1 225 Y 6 77636844 D254E A T missense Het possibly damaging 0.905 0.300 phenotype 04/30/2015
16 313404 UTSW Dlec1 0.000 R4024 G1 225 Y 9 119137340 Y1126H T C missense Het probably damaging 0.979 0.106 phenotype 04/30/2015
17 313376 UTSW Dzank1 0.000 R4024 G1 225 Y 2 144482227 S565G T C missense Het probably benign 0.000 0.090 phenotype 04/30/2015
18 313397 UTSW Eef2k 0.099 R4024 G1 225 Y 7 120858598 Y60C A G missense Het probably benign 0.007 0.064 phenotype 04/30/2015
19 313414 UTSW Fam208b 0.096 R4024 G1 225 Y 13 3584554 D751G T C missense Het probably damaging 0.985 0.266 04/30/2015
20 313384 UTSW Fbxl4 0.409 R4024 G1 225 Y 4 22377074 V170A T C missense Het possibly damaging 0.831 0.208 phenotype 04/30/2015
21 313412 UTSW Foxk2 0.000 R4024 G1 225 Y 11 121285613 I195N T A missense Het possibly damaging 0.669 0.182 phenotype 04/30/2015
22 313405 UTSW Gm10608 0.082 R4024 G1 104 N 9 119160716 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA small deletion Het probably benign 0.090 04/30/2015
23 313408 UTSW Gpr6 0.000 R4024 G1 202 Y 10 41071268 T106M G A missense Het probably damaging 0.999 0.402 phenotype 04/30/2015
24 313389 UTSW Grk3 0.000 R4024 G1 225 Y 5 112914984 N666Y T A missense Het possibly damaging 0.775 0.062 phenotype 04/30/2015
25 313373 UTSW Hnmt 0.176 R4024 G1 225 Y 2 24003765 D239G T C missense Het probably benign 0.000 0.083 phenotype 04/30/2015
26 313398 UTSW Igf2 0.445 R4024 G1 225 Y 7 142654307 V111A A G missense Het probably benign 0.230 0.057 phenotype 04/30/2015
27 313383 UTSW Lrriq3 0.094 R4024 G1 225 Y 3 155188302 E547K G A missense Het probably benign 0.432 0.090 04/30/2015
28 313380 UTSW Lrriq4 0.103 R4024 G1 225 Y 3 30650273 V150A T C missense Het possibly damaging 0.462 0.229 04/30/2015
29 313379 UTSW Mroh8 0.914 R4024 G1 225 Y 2 157256352 V292A A G missense Het probably benign 0.323 0.090 phenotype 04/30/2015
30 313402 UTSW Myo1e 0.000 R4024 G1 225 Y 9 70324875 I229V A G missense Het probably benign 0.000 0.253 phenotype 04/30/2015
31 313420 UTSW Nisch 0.000 R4024 G1 225 Y 14 31176819 A G unclassified Het probably benign 0.058 phenotype 04/30/2015
32 313377 UTSW Nkx2-2 1.000 R4024 G1 225 Y 2 147184234 T195A T C missense Het probably benign 0.071 0.069 phenotype 04/30/2015
33 313374 UTSW Olfr1132 0.113 R4024 G1 225 Y 2 87635155 L197F T A missense Het probably damaging 0.969 0.278 phenotype 04/30/2015
34 313411 UTSW Olfr328 0.061 R4024 G1 225 Y 11 58551396 T281I G A missense Het possibly damaging 0.897 0.372 phenotype 04/30/2015
35 313372 UTSW Olfr432 0.067 R4024 G1 225 Y 1 174051117 T248I C T missense Het probably benign 0.001 0.090 phenotype 04/30/2015
36 313396 UTSW Olfr487 0.083 R4024 G1 225 Y 7 108211742 Y262* A T nonsense Het probably null 0.966 phenotype 04/30/2015
37 313387 UTSW Plekhn1 0.084 R4024 G1 225 Y 4 156224750 V233A A G missense Het probably damaging 0.998 0.693 04/30/2015
38 313410 UTSW Ppp3r1 1.000 R4024 G1 225 Y 11 17194786 V133A T C missense Het probably damaging 1.000 0.879 phenotype 04/30/2015
39 313407 UTSW Sash1 1.000 R4024 G1 225 Y 10 8729917 D903G T C missense Het probably benign 0.001 0.090 phenotype 04/30/2015
40 313423 UTSW Scn8a 0.914 R4024 G1 225 Y 15 101039793 D1681G A G missense Het probably damaging 0.999 0.374 phenotype 04/30/2015
41 313427 UTSW Slk 1.000 R4024 G1 225 Y 19 47622370 A G splice site 4 bp Het probably null 0.976 phenotype 04/30/2015
42 313421 UTSW Tlr11 0.000 R4024 G1 225 Y 14 50362846 T763I C T missense Het probably benign 0.016 0.090 04/30/2015
43 313375 UTSW Ttbk2 1.000 R4024 G1 225 Y 2 120760255 T308A T C missense Het possibly damaging 0.911 0.061 phenotype 04/30/2015
44 313400 UTSW Tyk2 0.000 R4024 G1 225 Y 9 21115919 L552F G A missense Het probably damaging 0.995 0.244 phenotype 04/30/2015
45 313403 UTSW Ubp1 1.000 R4024 G1 225 Y 9 113944883 D50G A G missense Het probably benign 0.029 0.086 phenotype 04/30/2015
46 313385 UTSW Ugcg 1.000 R4024 G1 225 Y 4 59207798 P46S C T missense Het probably benign 0.175 0.080 phenotype 04/30/2015
47 313406 UTSW Ulk4 0.799 R4024 G1 175 Y 9 121044849 I1172N A T missense Het possibly damaging 0.859 0.203 phenotype 04/30/2015
48 475291 UTSW Usf3 0.237 R4024 G1 225 N 16 44216165 V336E T A missense Het possibly damaging 0.759 04/14/2017
49 313371 UTSW Vangl2 1.000 R4024 G1 225 Y 1 172008041 S355G T C missense Het probably benign 0.001 0.071 phenotype 04/30/2015
50 313415 UTSW Vmn1r216 0.223 R4024 G1 225 Y 13 23099891 D248G A G missense Het probably damaging 1.000 0.647 04/30/2015
51 313391 UTSW Vmn1r34 0.073 R4024 G1 225 Y 6 66637704 M17L T A missense Het probably benign 0.000 0.090 04/30/2015
52 313425 UTSW Vmn2r120 0.110 R4024 G1 104 Y 17 57536718 D42V T A missense Het possibly damaging 0.924 0.179 04/30/2015
53 313381 UTSW Vmn2r6 0.299 R4024 G1 188 Y 3 64538250 S685T A T missense Het possibly damaging 0.732 0.179 04/30/2015
54 313395 UTSW Vsig10l 0.163 R4024 G1 210 Y 7 43468086 V701A T C missense Het probably benign 0.326 0.090 04/30/2015
55 313388 UTSW Wdfy3 0.937 R4024 G1 225 Y 5 101924095 A G splice site Het probably benign 0.090 phenotype 04/30/2015
56 313417 UTSW Zfp808 0.080 R4024 G1 158 N 13 62171730 C258S T A missense Het possibly damaging 0.711 04/30/2015
57 368355 UTSW Zfp988 0.165 R4024 G1 29 Y 4 147332785 K559Q A C missense Het probably benign 0.000 0.090 02/01/2016
[records 1 to 57 of 57]