Incidental Mutations

68 incidental mutations are currently displayed, and affect 67 genes.
9 are Possibly Damaging.
27 are Probably Damaging.
24 are Probably Benign.
8 are Probably Null.
2 create premature stop codons.
4 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 68 of 68] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 316829 UTSW 1110008L16Rik 0.497 R4080 G1 225 N 12 55304613 V236F G T missense Het possibly damaging 0.876 0.160 05/15/2015
2 316811 UTSW Aass 0.000 R4080 G1 225 N 6 23109498 D324E A T missense Het possibly damaging 0.829 0.088 phenotype 05/15/2015
3 316837 UTSW Adam7 0.057 R4080 G1 225 N 14 68520539 T245A T C missense Het probably benign 0.051 phenotype 05/15/2015
4 316804 UTSW Adgrf3 0.000 R4080 G1 225 N 5 30197369 Q554* G A nonsense Het probably null 05/15/2015
5 316790 UTSW Aim2 0.072 R4080 G1 225 N 1 173459851 T C critical splice donor site 2 bp Het probably null 0.889 phenotype 05/15/2015
6 316814 UTSW Arhgef1 0.329 R4080 G1 225 N 7 24925846 D850Y G T missense Het probably damaging 0.965 0.109 phenotype 05/15/2015
7 500482 UTSW Aspm 0.000 R4080 G1 225 N 1 139470755 Q1024K C A missense Het probably damaging 0.998 phenotype 12/01/2017
8 316838 UTSW C7 0.000 R4080 G1 225 N 15 4990464 S734G T C missense Het probably benign 0.089 phenotype 05/15/2015
9 316806 UTSW Ccdc158 0.155 R4080 G1 225 N 5 92623396 S987T A T missense Het probably benign 0.001 05/15/2015
10 316835 UTSW Chrna2 0.000 R4080 G1 225 N 14 66143417 G45V G T missense Het probably benign 0.120 phenotype 05/15/2015
11 316836 UTSW Chrna2 0.000 R4080 G1 225 N 14 66143424 Y47* C A nonsense Het probably null phenotype 05/15/2015
12 316812 UTSW Clec2g 0.138 R4080 G1 225 N 6 128981324 Q117K C A missense Het probably damaging 0.963 05/15/2015
13 316789 UTSW Cntnap5a 0.000 R4080 G1 225 N 1 116101574 S253G A G missense Het probably benign 0.012 phenotype 05/15/2015
14 316818 UTSW Cttn 0.219 R4080 G1 225 N 7 144457724 D116V T A missense Het probably damaging 1.000 phenotype 05/15/2015
15 316856 UTSW Cyp2c40 0.099 R4080 G1 225 N 19 39802529 V286A A G missense Het probably benign 0.015 05/15/2015
16 316846 UTSW Dcbld2 0.000 R4080 G1 225 N 16 58465373 S632T T A missense Het probably damaging 0.998 phenotype 05/15/2015
17 316848 UTSW Dscam 1.000 R4080 G1 225 N 16 96683772 N1118K A T missense Het probably benign 0.011 phenotype 05/15/2015
18 316795 UTSW Eif2a 0.000 R4080 G1 225 N 3 58539629 T92M C T missense Het possibly damaging 0.519 phenotype 05/15/2015
19 316799 UTSW Frmpd1 0.000 R4080 G1 225 N 4 45284382 C1068S T A missense Het probably benign 0.000 05/15/2015
20 500484 UTSW Fstl1 0.671 R4080 G1 225 N 16 37822603 V110I G A missense Het probably benign 0.055 phenotype 12/01/2017
21 316794 UTSW Gpat2 0.000 R4080 G1 225 N 2 127433622 I465T T C missense Het probably damaging 0.993 05/15/2015
22 316855 UTSW Gpr137 0.000 R4080 G1 225 N 19 6940423 C T intron Het probably benign 05/15/2015
23 316820 UTSW Hgsnat 0.000 R4080 G1 225 N 8 25946343 I561T A G missense Het probably benign 0.023 phenotype 05/15/2015
24 316800 UTSW Ift74 0.000 R4080 G1 225 N 4 94652912 T A splice site Het probably null phenotype 05/15/2015
25 316823 UTSW Ilf3 1.000 R4080 G1 225 N 9 21403134 A G critical splice acceptor site Het probably null phenotype 05/15/2015
26 316850 UTSW Kcnh8 0.000 R4080 G1 217 N 17 52725906 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA small deletion Het probably benign 0.090 phenotype 05/15/2015
27 316815 UTSW Klk14 0.000 R4080 G1 225 N 7 43692077 C51Y G A missense Het probably damaging 1.000 0.793 phenotype 05/15/2015
28 316801 UTSW Lrrc41 0.574 R4080 G1 225 N 4 116080546 C A splice site Het probably null 05/15/2015
29 316845 UTSW Myh11 1.000 R4080 G1 225 N 16 14224059 R700L C A missense Het possibly damaging 0.831 phenotype 05/15/2015
30 316819 UTSW Myo16 0.453 R4080 G1 225 N 8 10562240 D1295G A G missense Het probably damaging 1.000 phenotype 05/15/2015
31 316853 UTSW Myo5b 0.547 R4080 G1 225 N 18 74740488 M1488V A G missense Het probably benign 0.000 phenotype 05/15/2015
32 316834 UTSW Naip6 0.126 R4080 G1 225 N 13 100299307 Y903N A T missense Het probably damaging 1.000 phenotype 05/15/2015
33 316793 UTSW Nek6 0.144 R4080 G1 225 N 2 38550637 H19R A G missense Het probably damaging 0.988 phenotype 05/15/2015
34 316824 UTSW Nktr 0.621 R4080 G1 225 N 9 121741126 T127P A C missense Het probably damaging 1.000 phenotype 05/15/2015
35 316807 UTSW Noc4l 0.954 R4080 G1 225 N 5 110649872 D335E A T missense Het probably benign 0.012 05/15/2015
36 316833 UTSW Nsd1 1.000 R4080 G1 225 N 13 55301809 D1993G A G missense Het probably damaging 0.957 phenotype 05/15/2015
37 316826 UTSW Olfr1377 0.085 R4080 G1 225 N 11 50984856 D52N G A missense Het probably damaging 1.000 phenotype 05/15/2015
38 316847 UTSW Olfr190 0.055 R4080 G1 225 N 16 59074256 F275I A T missense Het probably damaging 0.958 phenotype 05/15/2015
39 316852 UTSW Pabpc2 0.113 R4080 G1 225 N 18 39775530 Q616L A T missense Het possibly damaging 0.861 05/15/2015
40 316851 UTSW Pcdhga4 0.117 R4080 G1 225 N 18 37685779 D127V A T missense Het probably damaging 1.000 phenotype 05/15/2015
41 316817 UTSW Phrf1 0.000 R4080 G1 225 N 7 141259720 T C unclassified Het probably benign 05/15/2015
42 500483 UTSW Phtf2 0.000 R4080 G1 225 N 5 20813296 I16F T A missense Het probably damaging 0.998 12/01/2017
43 316831 UTSW Plekhg3 0.000 R4080 G1 225 N 12 76577981 R1200L G T missense Het probably benign 0.022 05/15/2015
44 316809 UTSW Plod3 1.000 R4080 G1 225 N 5 136988146 A50P G C missense Het probably benign 0.382 0.104 phenotype 05/15/2015
45 316797 UTSW Prss12 0.148 R4080 G1 225 N 3 123485485 N404D A G missense Het probably benign 0.435 phenotype 05/15/2015
46 316802 UTSW Ptch2 0.000 R4080 G1 225 N 4 117111206 A926G C G missense Het probably damaging 0.996 phenotype 05/15/2015
47 316792 UTSW Ptpa 0.946 R4080 G1 225 N 2 30443305 F6L T C missense Het probably damaging 1.000 phenotype 05/15/2015
48 316798 UTSW Reck 1.000 R4080 G1 225 N 4 43942293 I853T T C missense Het possibly damaging 0.952 phenotype 05/15/2015
49 316825 UTSW Reep6 0.056 R4080 G1 85 N 10 80330162 G A utr 5 prime Het probably benign 05/15/2015
50 316803 UTSW Rex2 0.176 R4080 G1 89 N 4 147058697 S547R T A missense Het probably benign 0.000 05/15/2015
51 316840 UTSW Rgs22 0.000 R4080 G1 225 N 15 36107076 E55K C T missense Het probably damaging 0.998 05/15/2015
52 316844 UTSW Rtl6 0.088 R4080 G1 225 N 15 84557001 T65A T C missense Het possibly damaging 0.767 05/15/2015
53 316808 UTSW Scarb1 0.000 R4080 G1 225 N 5 125277795 P491Q G T missense Het probably damaging 1.000 phenotype 05/15/2015
54 316828 UTSW Scfd1 0.956 R4080 G1 225 N 12 51431519 S505G A G missense Het probably benign 0.000 05/15/2015
55 316843 UTSW Scube1 0.150 R4080 G1 225 N 15 83608747 Q904P T G missense Het probably damaging 0.999 phenotype 05/15/2015
56 316796 UTSW Sis 0.000 R4080 G1 225 N 3 72921184 Y1186C T C missense Het probably damaging 1.000 phenotype 05/15/2015
57 316791 UTSW Spta1 0.533 R4080 G1 225 N 1 174214066 D1334G A G missense Het probably benign 0.005 0.090 phenotype 05/15/2015
58 316816 UTSW Spty2d1 0.919 R4080 G1 225 N 7 46998581 E200G T C missense Het probably damaging 0.986 05/15/2015
59 316810 UTSW Stard13 0.000 R4080 G1 225 N 5 151092829 C A critical splice acceptor site Het probably null 0.949 phenotype 05/15/2015
60 316841 UTSW Sybu 0.070 R4080 G1 225 N 15 44718943 K95R T C missense Het probably damaging 1.000 phenotype 05/15/2015
61 316842 UTSW Trappc9 0.000 R4080 G1 225 N 15 72941947 D488V T A missense Het probably damaging 0.997 phenotype 05/15/2015
62 316805 UTSW Txk 0.000 R4080 G1 225 N 5 72700663 P381S G A missense Het probably damaging 1.000 phenotype 05/15/2015
63 316849 UTSW Ubr2 0.894 R4080 G1 225 N 17 46988722 M198K A T missense Het probably benign 0.048 phenotype 05/15/2015
64 316832 UTSW Unc5a 0.000 R4080 G1 225 N 13 55004481 T786S A T missense Het possibly damaging 0.615 phenotype 05/15/2015
65 316854 UTSW Unc93b1 0.000 R4080 G1 225 N 19 3941959 R231Q G A missense Het probably damaging 0.985 phenotype 05/15/2015
66 316821 UTSW Wfdc1 0.000 R4080 G1 225 N 8 119683793 T A critical splice donor site 2 bp Het probably null phenotype 05/15/2015
67 316813 UTSW Zfp667 0.064 R4080 G1 225 N 7 6305106 C258G T G missense Het possibly damaging 0.711 05/15/2015
68 316839 UTSW Zfr 1.000 R4080 G1 225 N 15 12162233 R823H G A missense Het probably benign 0.079 0.072 phenotype 05/15/2015
[records 1 to 68 of 68]