Incidental Mutations

32 incidental mutations are currently displayed, and affect 32 genes.
1 are Possibly Damaging.
17 are Probably Damaging.
11 are Probably Benign.
3 are Probably Null.
1 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 32 of 32] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 315140 UTSW 4930444G20Rik 0.179 R4117 G1 225 Y 10 22067716 N122Y T A missense Het probably benign 0.000 0.090 05/14/2015
2 315122 UTSW Acss2 0.379 R4117 G1 225 Y 2 155556393 F358L T C missense Het probably damaging 1.000 0.872 phenotype 05/14/2015
3 315145 UTSW Adamts16 0.000 R4117 G1 225 Y 13 70767992 Y775H A G missense Het probably benign 0.007 0.104 phenotype 05/14/2015
4 315119 UTSW Bard1 1.000 R4117 G1 225 Y 1 71046763 H594Q A T missense Het probably damaging 1.000 0.930 phenotype 05/14/2015
5 368350 UTSW Cd109 0.000 R4117 G1 158 Y 9 78712500 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT critical splice acceptor site Het probably benign 0.090 phenotype 01/29/2016
6 315136 UTSW Cenpt 0.940 R4117 G1 225 Y 8 105849700 S73L G A missense Het probably benign 0.000 0.073 phenotype 05/14/2015
7 315141 UTSW Ctdnep1 1.000 R4117 G1 225 Y 11 69988671 A7D C A missense Het probably damaging 0.972 0.616 phenotype 05/14/2015
8 315123 UTSW Fam210b 0.000 R4117 G1 225 Y 2 172351566 S100P T C missense Het probably benign 0.251 0.248 05/14/2015
9 368351 UTSW Fyb 0.000 R4117 G1 225 Y 15 6630116 D434A A C missense Het probably damaging 0.963 0.067 phenotype 01/29/2016
10 315147 UTSW Gm11127 0.056 R4117 G1 124 N 17 36057604 D144G T C missense Het probably damaging 1.000 05/14/2015
11 315142 UTSW Gm11492 0.102 R4117 G1 225 Y 11 87568282 F494S T C missense Het probably damaging 1.000 0.259 05/14/2015
12 315150 UTSW Heph 0.000 R4117 G1 222 Y X 96500615 V615A T C missense Het probably benign 0.002 0.310 phenotype 05/14/2015
13 315139 UTSW Icam5 0.000 R4117 G1 225 Y 9 21037590 V746E T A missense Het probably damaging 0.989 0.442 phenotype 05/14/2015
14 315138 UTSW Maml2 0.000 R4117 G1 225 Y 9 13705934 Q192R A G missense Het probably damaging 0.999 0.103 05/14/2015
15 315148 UTSW Npas4 0.478 R4117 G1 225 Y 19 4987363 Y301C T C missense Het probably damaging 0.988 0.213 phenotype 05/14/2015
16 315129 UTSW Nup205 0.961 R4117 G1 225 N 6 35241012 Q1767* C T nonsense Het probably null phenotype 05/14/2015
17 315133 UTSW Olfr561 0.084 R4117 G1 225 Y 7 102774477 T A splice site Het probably null 0.976 phenotype 05/14/2015
18 315128 UTSW Pigg 0.063 R4117 G1 225 Y 5 108348042 R982G A G missense Het probably benign 0.150 0.090 phenotype 05/14/2015
19 315132 UTSW Plekhg2 0.310 R4117 G1 225 Y 7 28360888 H1005Q A T missense Het probably benign 0.018 0.062 05/14/2015
20 315143 UTSW Rdh12 0.000 R4117 G1 225 Y 12 79213645 R172C C T missense Het probably damaging 0.989 0.647 phenotype 05/14/2015
21 315120 UTSW Rufy4 0.263 R4117 G1 225 Y 1 74147663 C537R T C missense Het probably damaging 0.988 0.860 05/14/2015
22 315144 UTSW Serpinb9 0.106 R4117 G1 225 Y 13 33015596 D291E T A missense Het probably benign 0.258 0.445 phenotype 05/14/2015
23 315125 UTSW She 0.197 R4117 G1 225 Y 3 89852372 Y394F A T missense Het probably damaging 0.998 0.305 05/14/2015
24 315137 UTSW Sipa1l2 0.346 R4117 G1 225 Y 8 125468510 S830G T C missense Het probably damaging 0.999 0.065 phenotype 05/14/2015
25 315146 UTSW Stmn4 0.000 R4117 G1 225 Y 14 66361132 *217Q T C makesense Het probably null 0.856 05/14/2015
26 315126 UTSW Stx17 1.000 R4117 G1 225 Y 4 48180689 D178G A G missense Het probably damaging 1.000 0.670 05/14/2015
27 315135 UTSW Tbc1d9 0.350 R4117 G1 225 Y 8 83266147 I960S T G missense Het possibly damaging 0.927 0.067 05/14/2015
28 315127 UTSW Ubxn10 0.081 R4117 G1 225 Y 4 138720965 D133E G T missense Het probably benign 0.012 0.090 05/14/2015
29 315130 UTSW Vmn2r42 R4117 G1 225 N 7 8194840 Y260C T C missense Het probably damaging 1.000 05/14/2015
30 315124 UTSW Vmn2r7 0.123 R4117 G1 225 Y 3 64715717 A C intron Het probably benign 0.090 05/14/2015
31 315134 UTSW Zfp143 0.956 R4117 G1 225 Y 7 110091913 T557I C T missense Het probably damaging 0.972 0.279 phenotype 05/14/2015
32 315131 UTSW Zfp607b 0.073 R4117 G1 225 Y 7 27698682 I64V A G missense Het probably damaging 0.972 0.367 05/14/2015
[records 1 to 32 of 32]