Incidental Mutations

44 incidental mutations are currently displayed, and affect 44 genes.
8 are Possibly Damaging.
13 are Probably Damaging.
16 are Probably Benign.
7 are Probably Null.
2 create premature stop codons.
0 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 44 of 44] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 315048 UTSW AI593442 0.109 R4154 G1 225 Y 9 52677904 H124Q A T missense Het probably benign 0.000 0.090 05/14/2015
2 315033 UTSW Asph 0.000 R4154 G1 225 Y 4 9639250 W38* C T nonsense Het probably null 0.975 phenotype 05/14/2015
3 315060 UTSW Bicdl2 0.129 R4154 G1 158 Y 17 23666092 A G splice site 4 bp Het probably null 0.976 05/14/2015
4 315056 UTSW Chd8 1.000 R4154 G1 225 Y 14 52207211 T C unclassified Het probably benign phenotype 05/14/2015
5 315041 UTSW Clcn4 0.000 R4154 G1 225 Y 7 7294834 N67D T C missense Het probably benign 0.017 0.160 phenotype 05/14/2015
6 315038 UTSW Cptp 0.190 R4154 G1 225 Y 4 155867200 V12A A G missense Het possibly damaging 0.455 0.121 05/14/2015
7 315062 UTSW Crim1 1.000 R4154 G1 225 Y 17 78237843 I145V A G missense Het probably benign 0.009 0.058 phenotype 05/14/2015
8 315043 UTSW Ctsc 0.071 R4154 G1 225 Y 7 88299547 M195I G A missense Het probably benign 0.015 0.090 phenotype 05/14/2015
9 315054 UTSW Ddx41 1.000 R4154 G1 225 Y 13 55534480 R205W G A missense Het possibly damaging 0.868 0.179 phenotype 05/14/2015
10 315067 UTSW Fas 0.139 R4154 G1 225 Y 19 34318828 I180S T G missense Het possibly damaging 0.716 0.208 phenotype 05/14/2015
11 315027 UTSW Fsip2 0.204 R4154 G1 225 Y 2 82987069 E4382A A C missense Het possibly damaging 0.707 0.233 phenotype 05/14/2015
12 315026 UTSW Galnt5 0.000 R4154 G1 225 Y 2 57998493 L35R T G missense Het probably damaging 1.000 0.114 phenotype 05/14/2015
13 315050 UTSW Gfpt2 0.000 R4154 G1 225 Y 11 49835778 G A splice site 5 bp Het probably null 0.976 05/14/2015
14 315063 UTSW Gjd4 0.000 R4154 G1 225 Y 18 9280811 S89* G T nonsense Het probably null 0.976 phenotype 05/14/2015
15 315029 UTSW Gm14496 0.000 R4154 G1 225 Y 2 181995079 H110L A T missense Het probably benign 0.012 0.090 05/14/2015
16 315055 UTSW Golm1 0.080 R4154 G1 225 Y 13 59642353 V211A A G missense Het probably benign 0.010 0.090 phenotype 05/14/2015
17 315058 UTSW Gsc2 0.000 R4154 G1 144 N 16 17914802 TGCAGCAGCAGCAGCAG TGCAGCAGCAGCAG small deletion Het probably benign phenotype 05/14/2015
18 315053 UTSW Ighv1-72 0.162 R4154 G1 225 Y 12 115758397 M7K A T missense Het probably benign 0.020 0.090 05/14/2015
19 315040 UTSW Igkv12-44 0.272 R4154 G1 225 Y 6 69814655 C108Y C T missense Het possibly damaging 0.952 0.179 05/14/2015
20 315049 UTSW Lum 0.222 R4154 G1 225 Y 10 97568953 S237P T C missense Het probably damaging 1.000 0.535 phenotype 05/14/2015
21 315037 UTSW Macf1 1.000 R4154 G1 225 Y 4 123471813 K3052E T C missense Het probably damaging 0.998 0.068 phenotype 05/14/2015
22 315034 UTSW Mdn1 1.000 R4154 G1 225 Y 4 32707475 E1588G A G missense Het probably damaging 0.959 0.341 05/14/2015
23 315031 UTSW Ndst3 0.228 R4154 G1 225 Y 3 123672227 Y32C T C missense Het probably damaging 0.999 0.122 phenotype 05/14/2015
24 315045 UTSW Nucb2 0.193 R4154 G1 225 Y 7 116527667 T172A A G missense Het probably benign 0.001 0.058 phenotype 05/14/2015
25 315044 UTSW Olfr690 0.066 R4154 G1 225 Y 7 105329385 N269S T C missense Het probably damaging 0.999 0.647 phenotype 05/14/2015
26 315047 UTSW Pard3 1.000 R4154 G1 225 Y 8 127474396 R978L G T missense Het probably damaging 0.998 0.119 phenotype 05/14/2015
27 315065 UTSW Pcdha4 0.171 R4154 G1 225 Y 18 36953586 A G intron 20914 bp Het probably null 0.948 phenotype 05/14/2015
28 315061 UTSW Pgk2 0.111 R4154 G1 225 Y 17 40208258 V93A A G missense Het probably damaging 0.998 0.915 phenotype 05/14/2015
29 315064 UTSW Pik3c3 1.000 R4154 G1 225 Y 18 30311283 M516I G A missense Het probably benign 0.348 0.095 phenotype 05/14/2015
30 368338 UTSW Plxnb2 0.957 R4154 G1 225 Y 15 89159642 F1336L A G missense Het probably damaging 0.984 0.192 phenotype 01/29/2016
31 315039 UTSW Shroom3 1.000 R4154 G1 225 Y 5 92943086 V1151F G T missense Het probably damaging 0.997 0.647 phenotype 05/14/2015
32 315052 UTSW Sipa1l1 0.000 R4154 G1 225 Y 12 82425214 G1323R G C missense Het possibly damaging 0.950 0.099 05/14/2015
33 315023 UTSW Sntg1 0.086 R4154 G1 225 Y 1 8583345 A T splice site Het probably null 0.976 phenotype 05/14/2015
34 315057 UTSW Spef2 0.120 R4154 G1 225 Y 15 9626021 K1153R T C missense Het probably benign 0.128 0.074 phenotype 05/14/2015
35 315051 UTSW Strn3 1.000 R4154 G1 225 Y 12 51627131 V566M C T missense Het probably damaging 0.999 0.647 05/14/2015
36 315035 UTSW Svep1 1.000 R4154 G1 225 Y 4 58069068 F2906S A G missense Het possibly damaging 0.711 0.412 phenotype 05/14/2015
37 315025 UTSW Tbc1d8 0.000 R4154 G1 225 Y 1 39386135 V545M C T missense Het probably damaging 0.990 0.647 05/14/2015
38 315024 UTSW Tmem131 0.749 R4154 G1 225 Y 1 36808793 T C intron Het probably benign 0.090 05/14/2015
39 315036 UTSW Tnfsf8 0.000 R4154 G1 225 Y 4 63834358 S157P A G missense Het probably benign 0.002 0.090 phenotype 05/14/2015
40 315042 UTSW Tubgcp5 0.963 R4154 G1 225 Y 7 55805329 V258M G A missense Het probably benign 0.008 0.090 05/14/2015
41 315046 UTSW Vat1l 0.067 R4154 G1 138 Y 8 114205803 G30R G C missense Het possibly damaging 0.945 0.086 05/14/2015
42 315066 UTSW Vegfb 0.000 R4154 G1 225 Y 19 6986078 Y106C T C missense Het probably damaging 1.000 0.284 phenotype 05/14/2015
43 315059 UTSW Vmn2r100 0.074 R4154 G1 217 Y 17 19523419 AAAACAGGAGTATTGATTGGAAAC AAAAC frame shift Het probably null 0.976 05/14/2015
44 315028 UTSW Zc3h15 0.669 R4154 G1 225 Y 2 83658569 V161A T C missense Het probably benign 0.065 0.088 05/14/2015
[records 1 to 44 of 44]