Incidental Mutations

34 incidental mutations are currently displayed, and affect 34 genes.
1 are Possibly Damaging.
17 are Probably Damaging.
13 are Probably Benign.
1 are Probably Null.
0 create premature stop codons.
0 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 34 of 34] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 319293 UTSW 2310050C09Rik 0.098 R4213 G1 225 Y 3 92869127 P83L G A missense Het probably benign 0.013 0.218 06/10/2015
2 319304 UTSW Ankrd11 1.000 R4213 G1 225 Y 8 122891026 V2029G A C missense Het probably benign 0.002 0.090 phenotype 06/10/2015
3 319316 UTSW Arhgap28 0.000 R4213 G1 225 Y 17 67871993 V291E A T missense Het probably benign 0.044 0.090 phenotype 06/10/2015
4 319296 UTSW Cad 0.969 R4213 G1 225 Y 5 31072344 V1390I G A missense Het probably benign 0.011 0.095 phenotype 06/10/2015
5 319297 UTSW Cadps2 0.000 R4213 G1 225 Y 6 23599463 D281E A T missense Het probably damaging 0.999 0.129 phenotype 06/10/2015
6 319314 UTSW Celsr1 0.675 R4213 G1 225 Y 15 86031807 T655I G A missense Het probably damaging 0.996 0.102 phenotype 06/10/2015
7 371094 UTSW Cep350 0.964 R4213 G1 225 Y 1 155935961 G411A C G missense Het probably damaging 1.000 0.075 phenotype 02/17/2016
8 319286 UTSW Chml 0.238 R4213 G1 225 Y 1 175686695 F210L A T missense Het probably damaging 1.000 0.188 phenotype 06/10/2015
9 319284 UTSW Col4a4 0.078 R4213 G1 225 Y 1 82453144 M1679K A T missense Het unknown 0.087 phenotype 06/10/2015
10 319312 UTSW Depdc1b 0.085 R4213 G1 225 Y 13 108388691 F527V T G missense Het probably damaging 1.000 0.144 06/10/2015
11 319317 UTSW Dsg2 0.246 R4213 G1 225 Y 18 20598514 L731P T C missense Het probably benign 0.014 0.132 phenotype 06/10/2015
12 319287 UTSW Fam69b 0.174 R4213 G1 225 Y 2 26635948 T298I C T missense Het probably benign 0.048 0.061 phenotype 06/10/2015
13 319301 UTSW Fbxo25 0.207 R4213 G1 225 Y 8 13939581 T343A A G missense Het probably damaging 1.000 0.326 phenotype 06/10/2015
14 319306 UTSW Gk5 0.000 R4213 G1 225 Y 9 96129053 L72P T C missense Het probably damaging 1.000 0.961 phenotype 06/10/2015
15 319299 UTSW Gm15448 0.051 R4213 G1 225 Y 7 3821554 A510S C A missense Het probably damaging 1.000 0.647 06/10/2015
16 319319 UTSW Gm648 0.000 R4213 G1 222 Y X 56545208 V78I C T missense Het probably benign 0.000 0.090 06/10/2015
17 319313 UTSW Gpr137c 0.071 R4213 G1 225 Y 14 45246508 E231K G A missense Het probably damaging 0.988 0.117 06/10/2015
18 319290 UTSW Hdc 0.269 R4213 G1 225 Y 2 126597866 C T splice site 5 bp Het probably null 0.976 phenotype 06/10/2015
19 319303 UTSW Hydin 0.709 R4213 G1 225 Y 8 110456507 N1112S A G missense Het possibly damaging 0.907 0.101 phenotype 06/10/2015
20 319308 UTSW Itgae 0.000 R4213 G1 225 Y 11 73119352 H556R A G missense Het probably benign 0.000 0.090 phenotype 06/10/2015
21 319315 UTSW Kcnh8 0.000 R4213 G1 217 Y 17 52725906 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA small deletion Het probably benign 0.090 phenotype 06/10/2015
22 319310 UTSW Krtap17-1 0.000 R4213 G1 211 Y 11 99993914 L9P A G missense Het unknown 0.087 06/10/2015
23 319285 UTSW Nmur1 0.000 R4213 G1 225 Y 1 86387784 T87P T G missense Het probably damaging 0.999 0.647 phenotype 06/10/2015
24 319288 UTSW Olfr1155 0.072 R4213 G1 225 Y 2 87943121 Y169C T C missense Het probably benign 0.001 0.090 phenotype 06/10/2015
25 319311 UTSW Ppp2r5e 0.000 R4213 G1 225 Y 12 75469551 I244T A G missense Het probably damaging 1.000 0.940 phenotype 06/10/2015
26 319305 UTSW Robo3 1.000 R4213 G1 225 Y 9 37421898 G781D C T missense Het probably damaging 1.000 0.078 phenotype 06/10/2015
27 319291 UTSW Siglec1 0.070 R4213 G1 225 Y 2 131074118 E1275K C T missense Het probably damaging 1.000 0.470 phenotype 06/10/2015
28 319307 UTSW Slc2a12 0.000 R4213 G1 225 Y 10 22702094 K596N A T missense Het probably benign 0.024 0.077 phenotype 06/10/2015
29 319318 UTSW Sorcs1 0.102 R4213 G1 225 Y 19 50225175 R705C G A missense Het probably damaging 0.980 0.647 phenotype 06/10/2015
30 319289 UTSW Sqor 0.000 R4213 G1 225 Y 2 122787498 G92V G T missense Het probably damaging 1.000 0.965 phenotype 06/10/2015
31 319295 UTSW Tlr4 0.000 R4213 G1 225 Y 4 66840326 I452N T A missense Het probably damaging 1.000 0.901 phenotype 06/10/2015
32 319309 UTSW Tob1 0.000 R4213 G1 225 Y 11 94214192 T185A A G missense Het probably damaging 0.995 0.131 phenotype 06/10/2015
33 319302 UTSW Yjefn3 0.142 R4213 G1 225 Y 8 69890890 H50Q G T missense Het probably benign 0.148 0.090 06/10/2015
34 319292 UTSW Zswim1 0.120 R4213 G1 225 Y 2 164825785 V319A T C missense Het probably benign 0.147 0.069 06/10/2015
[records 1 to 34 of 34]