Incidental Mutations

44 incidental mutations are currently displayed, and affect 44 genes.
10 are Possibly Damaging.
13 are Probably Damaging.
14 are Probably Benign.
6 are Probably Null.
1 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 44 of 44] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 320551 UTSW 2700062C07Rik 0.906 R4249 G1 225 N 18 24472956 N36S A G missense Het possibly damaging 0.732 0.179 06/12/2015
2 320530 UTSW 2810474O19Rik 0.000 R4249 G1 225 N 6 149325543 M29K T A missense Het possibly damaging 0.873 0.179 06/12/2015
3 320513 UTSW Ankrd39 0.093 R4249 G1 207 N 1 36547155 S11P A G missense Het probably benign 0.003 06/12/2015
4 320515 UTSW Aox2 0.072 R4249 G1 225 N 1 58299819 S324G A G missense Het probably benign 0.013 06/12/2015
5 320554 UTSW Atl3 0.000 R4249 G1 225 N 19 7532338 V477A T C missense Het probably benign 0.063 phenotype 06/12/2015
6 320537 UTSW Bcar1 1.000 R4249 G1 225 N 8 111720893 T151A T C missense Het probably benign 0.000 phenotype 06/12/2015
7 320553 UTSW Cdc42bpg 0.344 R4249 G1 118 N 19 6315266 T718A A G missense Het possibly damaging 0.647 06/12/2015
8 320512 UTSW Col9a1 0.141 R4249 G1 225 N 1 24244381 R843C C T missense Het probably damaging 0.999 phenotype 06/12/2015
9 320543 UTSW Dnah12 0.201 R4249 G1 225 N 14 26709186 D316E T A missense Het possibly damaging 0.699 06/12/2015
10 320542 UTSW Fat2 0.000 R4249 G1 225 N 11 55284301 V1862A A G missense Het probably damaging 0.979 phenotype 06/12/2015
11 320518 UTSW Fbxw5 0.373 R4249 G1 225 N 2 25503460 N233K C A missense Het probably damaging 0.979 phenotype 06/12/2015
12 320536 UTSW Fcer2a 0.000 R4249 G1 225 N 8 3688831 F75L A G missense Het probably benign 0.001 phenotype 06/12/2015
13 320552 UTSW Fhod3 1.000 R4249 G1 225 N 18 24990066 K271R A G missense Het probably null 0.996 0.249 phenotype 06/12/2015
14 320520 UTSW Gimd1 0.115 R4249 G1 225 N 3 132644408 V144A T C missense Het possibly damaging 0.945 06/12/2015
15 320526 UTSW Glt1d1 0.057 R4249 G1 225 N 5 127691112 T C critical splice donor site 2 bp Het probably null 06/12/2015
16 320514 UTSW Hecw2 0.282 R4249 G1 225 N 1 53832645 V1381M C T missense Het probably damaging 1.000 0.593 phenotype 06/12/2015
17 320516 UTSW Kansl1l 0.216 R4249 G1 225 N 1 66773478 D459N C T missense Het probably damaging 1.000 06/12/2015
18 320533 UTSW Lmtk3 0.584 R4249 G1 160 N 7 45794062 C723Y G A missense Het possibly damaging 0.752 0.059 phenotype 06/12/2015
19 320545 UTSW Muc4 0.122 R4249 G1 225 N 16 32755826 T C unclassified Het probably benign phenotype 06/12/2015
20 320549 UTSW Myom1 0.000 R4249 G1 225 N 17 71092140 V999E T A missense Het probably damaging 1.000 phenotype 06/12/2015
21 320517 UTSW Nckap5 0.000 R4249 G1 225 N 1 126027639 L460P A G missense Het probably benign 0.007 06/12/2015
22 320548 UTSW Olfr109 0.068 R4249 G1 225 N 17 37466824 M206T T C missense Het probably damaging 0.975 phenotype 06/12/2015
23 320522 UTSW Phf13 0.221 R4249 G1 225 N 4 151992095 N213K A T missense Het probably damaging 0.996 phenotype 06/12/2015
24 320531 UTSW Phldb3 0.123 R4249 G1 225 N 7 24627320 I591T T C missense Het probably damaging 1.000 06/12/2015
25 320539 UTSW Pik3cb 0.964 R4249 G1 225 N 9 99101176 T C splice site Het probably null 0.976 phenotype 06/12/2015
26 320541 UTSW Pkd1l1 1.000 R4249 G1 225 N 11 8865543 R1456K C T missense Het possibly damaging 0.506 0.179 phenotype 06/12/2015
27 320550 UTSW Plekhh2 0.106 R4249 G1 225 N 17 84586337 E860G A G missense Het possibly damaging 0.934 06/12/2015
28 320525 UTSW Rest 1.000 R4249 G1 225 N 5 77282112 T793A A G missense Het probably benign 0.000 phenotype 06/12/2015
29 320546 UTSW Ropn1 0.136 R4249 G1 225 N 16 34678456 Q205* C T nonsense Het probably null phenotype 06/12/2015
30 320544 UTSW Sacs 0.000 R4249 G1 225 N 14 61203457 K984T A C missense Het probably benign 0.016 phenotype 06/12/2015
31 320523 UTSW Samd11 0.109 R4249 G1 225 N 4 156250486 R102C G A missense Het probably damaging 1.000 06/12/2015
32 320556 UTSW Satl1 0.067 R4249 G1 222 N X 112406336 S141P A G missense Het probably benign 0.000 0.090 06/12/2015
33 320532 UTSW Shank1 0.242 R4249 G1 225 N 7 44319736 H352N C A missense Het unknown phenotype 06/12/2015
34 320555 UTSW Slc22a27 0.054 R4249 G1 168 N 19 7925879 I162K A T missense Het possibly damaging 0.643 06/12/2015
35 320527 UTSW Snx8 0.000 R4249 G1 202 N 5 140356045 L121P A G missense Het probably damaging 1.000 0.974 06/12/2015
36 320529 UTSW Sumf1 0.126 R4249 G1 225 N 6 108155013 V156G A C missense Het probably damaging 0.999 0.903 phenotype 06/12/2015
37 320521 UTSW Tln1 1.000 R4249 G1 225 N 4 43536104 V2027E A T missense Het probably damaging 1.000 phenotype 06/12/2015
38 320540 UTSW Trdn 0.067 R4249 G1 225 N 10 33450998 I594M A G missense Het probably benign 0.094 phenotype 06/12/2015
39 320535 UTSW Trim5 0.067 R4249 G1 225 N 7 104276815 E180Q C G missense Het possibly damaging 0.831 06/12/2015
40 500516 UTSW Tsen2 0.946 R4249 G1 225 N 6 115547824 A G splice site Het probably benign 0.090 phenotype 12/01/2017
41 320519 UTSW Tubb1 0.210 R4249 G1 225 N 2 174455733 E45V A T missense Het probably null 0.926 phenotype 06/12/2015
42 320534 UTSW Vmn2r67 0.110 R4249 G1 225 N 7 85150514 T A splice site 3 bp Het probably null 06/12/2015
43 320538 UTSW Zcchc14 0.000 R4249 G1 217 N 8 121604292 CTGATGGTGGTGGTGATGGTGGTGG CTGATGGTGGTGG small deletion Het probably benign 06/12/2015
44 320547 UTSW Zfp160 0.000 R4249 G1 225 N 17 21025738 F183L T A missense Het probably benign 0.111 06/12/2015
[records 1 to 44 of 44]