Incidental Mutations

41 incidental mutations are currently displayed, and affect 41 genes.
12 are Possibly Damaging.
13 are Probably Damaging.
9 are Probably Benign.
7 are Probably Null.
3 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 41 of 41] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 322430 UTSW Abi3bp 0.088 R4301 G1 225 Y 16 56556903 V95D T A missense Het probably damaging 0.997 0.116 06/20/2015
2 322402 UTSW Adamtsl2 1.000 R4301 G1 225 Y 2 27087283 D252G A G missense Het probably null 1.000 0.164 phenotype 06/20/2015
3 322407 UTSW Adgra3 0.000 R4301 G1 225 Y 5 49961078 R1043G T C missense Het possibly damaging 0.936 0.086 phenotype 06/20/2015
4 322424 UTSW Atxn7l1 0.148 R4301 G1 225 Y 12 33367238 D562G A G missense Het probably damaging 1.000 0.024 06/20/2015
5 322411 UTSW Ccdc70 0.061 R4301 G1 225 Y 8 21973212 V6A T C missense Het possibly damaging 0.669 0.030 06/20/2015
6 322417 UTSW Cdc25a 1.000 R4301 G1 225 Y 9 109889742 V337A T C missense Het probably benign 0.232 0.084 phenotype 06/20/2015
7 322405 UTSW Chil4 0.000 R4301 G1 129 Y 3 106203727 P284S G A missense Het possibly damaging 0.952 0.136 06/20/2015
8 322401 UTSW Crb1 0.341 R4301 G1 225 Y 1 139248830 S472P A G missense Het probably benign 0.011 0.156 phenotype 06/20/2015
9 322426 UTSW Fam193b 0.140 R4301 G1 225 Y 13 55542604 R740* G A nonsense Het probably null 0.582 06/20/2015
10 322434 UTSW Fer 0.000 R4301 G1 225 Y 17 64078910 L292F G T missense Het probably damaging 1.000 0.029 phenotype 06/20/2015
11 322400 UTSW Gmppa 0.196 R4301 G1 225 Y 1 75442496 R349H G A missense Het possibly damaging 0.774 0.374 phenotype 06/20/2015
12 322432 UTSW Hspa1a 0.000 R4301 G1 225 Y 17 34970506 I474V T C missense Het probably benign 0.112 0.216 phenotype 06/20/2015
13 322433 UTSW Kcnh8 0.000 R4301 G1 217 Y 17 52725906 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA small deletion Het probably benign 0.131 phenotype 06/20/2015
14 322435 UTSW Lrrc30 0.000 R4301 G1 225 Y 17 67632568 S6P A G missense Het probably damaging 0.999 0.148 06/20/2015
15 322403 UTSW Lzts3 0.212 R4301 G1 225 Y 2 130636438 S133P A G missense Het probably damaging 0.985 0.312 06/20/2015
16 322429 UTSW Mkl2 1.000 R4301 G1 225 Y 16 13398305 Y294H T C missense Het probably damaging 1.000 0.398 phenotype 06/20/2015
17 368359 UTSW Mtmr12 0.000 R4301 G1 225 Y 15 12236020 F122I T A missense Het possibly damaging 0.950 0.134 phenotype 02/01/2016
18 322419 UTSW Mypn 0.184 R4301 G1 225 Y 10 63118484 Y124H A G missense Het probably damaging 1.000 0.358 phenotype 06/20/2015
19 322412 UTSW Nfat5 0.915 R4301 G1 225 Y 8 107355695 T C intron Het probably benign phenotype 06/20/2015
20 322406 UTSW Npr2 0.797 R4301 G1 225 Y 4 43641332 T C critical splice donor site 2 bp Het probably null 0.595 phenotype 06/20/2015
21 322438 UTSW Olfr1441 0.080 R4301 G1 225 Y 19 12422717 L136P T C missense Het probably damaging 0.984 0.068 phenotype 06/20/2015
22 322408 UTSW Pgm1 0.000 R4301 G1 225 Y 5 64103797 W51* G A nonsense Het probably null 0.620 phenotype 06/20/2015
23 322415 UTSW Phip 1.000 R4301 G1 225 Y 9 82959713 R48* G A nonsense Het probably null 0.642 phenotype 06/20/2015
24 322437 UTSW Piezo2 1.000 R4301 G1 225 Y 18 63084840 T1075A T C missense Het probably damaging 1.000 0.180 phenotype 06/20/2015
25 322409 UTSW Ppat 0.962 R4301 G1 225 Y 5 76928501 G T intron Het probably benign 0.100 phenotype 06/20/2015
26 322436 UTSW Ppp2r2b 0.000 R4301 G1 225 Y 18 42898746 E23D T A missense Het probably null 0.000 0.178 phenotype 06/20/2015
27 322428 UTSW Prickle1 1.000 R4301 G1 225 Y 15 93508636 I169V T C missense Het possibly damaging 0.817 0.276 phenotype 06/20/2015
28 322422 UTSW Rab37 0.072 R4301 G1 225 Y 11 115158564 D95E T A missense Het possibly damaging 0.532 0.196 phenotype 06/20/2015
29 322418 UTSW Sash1 1.000 R4301 G1 225 Y 10 8751470 V50A A G missense Het probably benign 0.002 0.020 phenotype 06/20/2015
30 322413 UTSW Siae 0.069 R4301 G1 225 Y 9 37633713 Q335K C A missense Het possibly damaging 0.512 0.184 phenotype 06/20/2015
31 322416 UTSW Snx14 1.000 R4301 G1 225 Y 9 88410623 I217K A T missense Het probably damaging 0.999 0.348 phenotype 06/20/2015
32 322431 UTSW Son 0.955 R4301 G1 225 Y 16 91658411 T1349A A G missense Het possibly damaging 0.528 0.038 phenotype 06/20/2015
33 322425 UTSW Sptb 0.817 R4301 G1 225 Y 12 76612697 L1143S A G missense Het probably damaging 1.000 0.028 phenotype 06/20/2015
34 322423 UTSW Trim80 0.080 R4301 G1 225 Y 11 115445113 T C critical splice donor site 2 bp Het probably null 0.617 06/20/2015
35 322439 UTSW Trpm3 0.125 R4301 G1 225 Y 19 22987292 S1374P T C missense Het probably benign 0.231 0.304 phenotype 06/20/2015
36 322440 UTSW Vldlr 0.318 R4301 G1 225 Y 19 27238402 D266E C A missense Het possibly damaging 0.795 0.061 phenotype 06/20/2015
37 322410 UTSW Vmn2r79 0.082 R4301 G1 225 Y 7 87001891 H166R A G missense Het possibly damaging 0.854 0.063 06/20/2015
38 322404 UTSW Zbtb10 0.315 R4301 G1 225 Y 3 9265160 Q526L A T missense Het probably damaging 0.961 0.078 06/20/2015
39 322420 UTSW Zfr2 0.076 R4301 G1 127 Y 10 81242184 T C unclassified Het probably benign 06/20/2015
40 322427 UTSW Zswim8 0.960 R4301 G1 225 Y 14 20713909 R449H G A missense Het possibly damaging 0.906 0.071 06/20/2015
41 322421 UTSW Zzef1 0.000 R4301 G1 225 Y 11 72889035 V1878A T C missense Het probably damaging 0.958 0.470 06/20/2015
[records 1 to 41 of 41]