Incidental Mutations

40 incidental mutations are currently displayed, and affect 40 genes.
4 are Possibly Damaging.
10 are Probably Damaging.
22 are Probably Benign.
3 are Probably Null.
1 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 40 of 40] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 322448 UTSW Agl 0.180 R4302 G1 225 Y 3 116746630 Y1445C T C missense Het probably damaging 1.000 0.973 phenotype 06/20/2015
2 322462 UTSW Arhgef12 0.922 R4302 G1 225 Y 9 43018349 Q217* G A nonsense Het probably null 0.975 phenotype 06/20/2015
3 322446 UTSW Bcas1 0.000 R4302 G1 215 Y 2 170418627 V44A A G missense Het probably benign 0.256 0.090 phenotype 06/20/2015
4 322449 UTSW Clic4 0.000 R4302 G1 225 Y 4 135226039 V98A A G missense Het probably benign 0.001 0.062 phenotype 06/20/2015
5 322442 UTSW Col6a3 0.000 R4302 G1 225 Y 1 90807614 I771N A T missense Het probably damaging 1.000 0.965 phenotype 06/20/2015
6 322445 UTSW Creb3l1 0.000 R4302 G1 225 Y 2 91993319 I183V T C missense Het probably damaging 0.997 0.081 phenotype 06/20/2015
7 322459 UTSW Dnhd1 0.093 R4302 G1 225 Y 7 105693954 W1502R T A missense Het probably damaging 0.999 0.479 06/20/2015
8 322460 UTSW Dync2h1 1.000 R4302 G1 186 Y 9 7077880 S2941T A T missense Het probably benign 0.020 0.073 phenotype 06/20/2015
9 322441 UTSW Gm973 0.130 R4302 G1 225 Y 1 59551240 Y302C A G missense Het possibly damaging 0.933 0.179 06/20/2015
10 322478 UTSW Hcfc1 0.957 R4302 G1 222 Y X 73949366 S1398P A G missense Het probably benign 0.151 0.098 phenotype 06/20/2015
11 322447 UTSW Igsf10 0.259 R4302 G1 225 Y 3 59318750 I2501V T C missense Het probably damaging 0.999 0.464 06/20/2015
12 322475 UTSW Kcnh8 0.000 R4302 G1 217 Y 17 52725906 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA small deletion Het probably benign 0.090 phenotype 06/20/2015
13 322477 UTSW Loxl4 0.000 R4302 G1 215 Y 19 42607591 Y141F T A missense Het probably benign 0.001 0.061 phenotype 06/20/2015
14 322457 UTSW Man2a2 0.235 R4302 G1 225 Y 7 80351739 E1140V T A missense Het possibly damaging 0.794 0.104 phenotype 06/20/2015
15 322451 UTSW Mgam 0.089 R4302 G1 225 Y 6 40763085 D1664G A G missense Het probably benign 0.022 0.131 phenotype 06/20/2015
16 322454 UTSW Mill2 0.053 R4302 G1 225 Y 7 18856531 T179S A T missense Het probably damaging 0.981 0.467 phenotype 06/20/2015
17 322468 UTSW Ncf4 0.000 R4302 G1 225 Y 15 78260762 T C unclassified Het probably benign 0.090 phenotype 06/20/2015
18 322469 UTSW Nol12 0.926 R4302 G1 225 Y 15 78940141 S154P T C missense Het probably damaging 1.000 0.092 06/20/2015
19 322466 UTSW Nupl1 0.943 R4302 G1 225 Y 14 60247426 S50P A G missense Het probably benign 0.435 0.090 phenotype 06/20/2015
20 322474 UTSW Olfr106-ps 0.210 R4302 G1 225 Y 17 37395486 N315K T A missense Het probably benign 0.000 06/20/2015
21 322465 UTSW Olfr736 0.085 R4302 G1 225 Y 14 50393446 I230T T C missense Het probably benign 0.229 0.090 phenotype 06/20/2015
22 322461 UTSW Olfr849 0.151 R4302 G1 225 Y 9 19440999 T29A A G missense Het probably benign 0.001 0.090 phenotype 06/20/2015
23 322443 UTSW Pdss1 1.000 R4302 G1 225 Y 2 22915505 I265T T C missense Het probably damaging 0.997 0.441 phenotype 06/20/2015
24 322476 UTSW Piezo2 1.000 R4302 G1 225 Y 18 63124730 T C critical splice acceptor site Het probably null 0.950 phenotype 06/20/2015
25 322463 UTSW Rad50 1.000 R4302 G1 225 Y 11 53702005 N106I T A missense Het probably benign 0.001 0.090 phenotype 06/20/2015
26 322455 UTSW Rhpn2 0.368 R4302 G1 225 Y 7 35390845 T631A A G missense Het probably benign 0.014 0.060 phenotype 06/20/2015
27 322456 UTSW Rps11 0.907 R4302 G1 225 Y 7 45122944 M80V T C missense Het probably benign 0.048 0.103 phenotype 06/20/2015
28 322458 UTSW Rrm1 0.970 R4302 G1 225 Y 7 102447824 Y104H T C missense Het probably benign 0.003 0.120 phenotype 06/20/2015
29 368317 UTSW Sgsm3 0.228 R4302 G1 225 Y 15 81010301 T A unclassified Het probably benign 0.090 01/25/2016
30 322472 UTSW Slc9c1 0.561 R4302 G1 225 Y 16 45544791 L162F A T missense Het probably benign 0.350 0.344 phenotype 06/20/2015
31 322473 UTSW Son 0.959 R4302 G1 225 Y 16 91658411 T1349A A G missense Het possibly damaging 0.528 0.179 phenotype 06/20/2015
32 322467 UTSW Stk24 0.333 R4302 G1 225 Y 14 121292082 L386S A G missense Het probably benign 0.070 0.127 phenotype 06/20/2015
33 322470 UTSW Tfcp2 0.000 R4302 G1 225 Y 15 100514849 N307K G T missense Het possibly damaging 0.775 0.179 phenotype 06/20/2015
34 322452 UTSW Trbv21 0.060 R4302 G1 225 Y 6 41202768 V6D T A missense Het probably benign 0.039 0.090 06/20/2015
35 322464 UTSW Trip11 1.000 R4302 G1 225 Y 12 101893768 D282E A T missense Het probably damaging 0.999 0.087 phenotype 06/20/2015
36 322444 UTSW Ttn 1.000 R4302 G1 225 Y 2 76876467 G T intron Het probably benign 0.085 phenotype 06/20/2015
37 322453 UTSW Vmn2r38 R4302 G1 120 N 7 9097563 A G splice site 6 bp Het probably null 06/20/2015
38 368316 UTSW Vmn2r-ps159 0.669 R4302 G1 20 Y 4 156334397 G T exon Het noncoding transcript 0.087 01/25/2016
39 322471 UTSW Vps8 1.000 R4302 G1 225 Y 16 21495914 L158Q T A missense Het probably damaging 1.000 0.151 06/20/2015
40 322450 UTSW Wdr66 0.136 R4302 G1 196 Y 5 123293810 I549T T C missense Het probably benign 0.332 0.090 phenotype 06/20/2015
[records 1 to 40 of 40]