Incidental Mutations

168 incidental mutations are currently displayed, and affect 153 genes.
10 are Possibly Damaging.
31 are Probably Damaging.
107 are Probably Benign.
17 are Probably Null.
6 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 168] next >> last >| per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 511256 UTSW 2810004N23Rik 0.562 FR4342 214.46 N 8 124839833 (GRCm38) TT TTATGT frame shift Homo probably null 2018-04-05
2 511206 UTSW 4930402H24Rik 0.000 FR4342 156.47 N 2 130770742 (GRCm38) TCC TCCCCC small insertion Het probably benign phenotype 2018-04-05
3 511245 UTSW 4930433I11Rik 0.067 FR4342 186.47 N 7 40993055 (GRCm38) AACC A small deletion Het probably benign 2018-04-05
4 511231 UTSW 4930548H24Rik 0.049 FR4342 214.46 N 5 31487373 (GRCm38) GAGAAG GAG small deletion Homo probably benign 2018-04-05
5 511293 UTSW 7530416G11Rik 0.069 FR4342 222 N 15 85494307 (GRCm38) E45V T A missense Homo unknown 2018-04-05
6 324205 UTSW Aars2 1.000 R4342 G1 225 Y 17 45516495 (GRCm38) C488R T C missense Het probably benign 0.000 0.090 phenotype 2015-06-24
7 324208 UTSW Adamts19 0.000 R4342 G1 225 Y 18 58942500 (GRCm38) H489L A T missense Het probably damaging 1.000 0.850 phenotype 2015-06-24
8 511250 UTSW AF366264 0.684 FR4342 87.01 N 8 13837613 (GRCm38) H159Q G C missense Het probably benign 0.002 2018-04-05
9 324210 UTSW Ahnak 0.260 R4342 G1 225 Y 19 9012083 (GRCm38) V3577A T C missense Het possibly damaging 0.794 0.073 phenotype 2015-06-24
10 511216 UTSW Ankrd35 0.000 FR4342 113.47 N 3 96683515 (GRCm38) TCCCC TCCC frame shift Het probably null 2018-04-05
11 511258 UTSW Anxa2 0.000 FR4342 130.47 N 9 69480205 (GRCm38) CCC CCCACC small insertion Het probably benign phenotype 2018-04-05
12 511259 UTSW Anxa2 0.000 FR4342 154.47 N 9 69480210 (GRCm38) C CCCA small insertion Het probably benign phenotype 2018-04-05
13 511302 UTSW Apc 0.970 FR4342 214.47 N 18 34281999 (GRCm38) CAATAAAGC CAATAAAGCAAATAAAGC intron Homo probably benign phenotype 2018-04-05
14 324186 UTSW Arhgap44 0.000 R4342 G1 119 Y 11 65012061 (GRCm38) R401* G A nonsense Het probably null 0.971 2015-06-24
15 511272 UTSW Arrb2 0.000 FR4342 222 N 11 70438671 (GRCm38) T269M C T missense Homo probably damaging 1.000 phenotype 2018-04-05
16 511275 UTSW Bcas3 0.686 FR4342 222 N 11 85509497 (GRCm38) V431I G A missense Homo probably benign 0.115 2018-04-05
17 511283 UTSW Begain 0.000 FR4342 123.97 N 12 109033418 (GRCm38) CCCCGCC CCCCGCCCCCGCC unclassified Homo probably benign 2018-04-05
18 511205 UTSW Catsper2 0.120 FR4342 210.47 N 2 121397793 (GRCm38) TCA TCAACA utr 3 prime Het probably benign phenotype 2018-04-05
19 324195 UTSW Cbx3-ps2 R4342 G1 225 Y 13 65559688 (GRCm38) T C intron Het noncoding transcript 0.087 2015-06-24
20 324171 UTSW Ccdc174 1.000 R4342 G1 225 Y 6 91885356 (GRCm38) L86* T A nonsense Het probably null 0.976 phenotype 2015-06-24
21 511263 UTSW Cd164 0.214 FR4342 222 N 10 41521926 (GRCm38) A59S G T missense Homo probably benign 0.003 0.090 phenotype 2018-04-05
22 511244 UTSW Cd22 0.000 FR4342 222 N 7 30878082 (GRCm38) R2H C T missense Homo possibly damaging 0.948 0.179 phenotype 2018-04-05
23 324163 UTSW Cd38 0.000 R4342 G1 225 Y 5 43869089 (GRCm38) I72L A C missense Het probably benign 0.003 0.090 phenotype 2015-06-24
24 324177 UTSW Cers4 0.000 R4342 G1 225 Y 8 4521223 (GRCm38) L264P T C missense Het probably damaging 0.999 0.880 phenotype 2015-06-24
25 324178 UTSW Cldn23 0.071 R4342 G1 225 Y 8 35825498 (GRCm38) S279P A G missense Het probably benign 0.002 0.069 phenotype 2015-06-24
26 511273 UTSW Cluh 0.233 FR4342 217.47 N 11 74669524 (GRCm38) GAGCCT GAGCCTCAGCCT small insertion Het probably benign phenotype 2018-04-05
27 511274 UTSW Cluh 0.233 FR4342 217.47 N 11 74669526 (GRCm38) GCCTGA GCCTGAACCTGA small insertion Het probably benign phenotype 2018-04-05
28 511279 UTSW Cntnap1 0.270 FR4342 217.47 N 11 101189575 (GRCm38) AGCCCC AGCCCCCGCCCC unclassified Het probably benign phenotype 2018-04-05
29 511294 UTSW Col2a1 1.000 FR4342 225.01 N 15 97988981 (GRCm38) C A splice site Het probably null 0.976 phenotype 2018-04-05
30 511261 UTSW Col6a5 0.845 FR4342 222 N 9 105934174 (GRCm38) N715K A T missense Homo unknown phenotype 2018-04-05
31 511268 UTSW Cpeb4 0.351 FR4342 108.46 N 11 31927638 (GRCm38) T TGA critical splice acceptor site Homo probably benign phenotype 2018-04-05
32 324162 UTSW Cth 0.000 R4342 G1 225 Y 3 157924976 (GRCm38) T19S T A missense Het probably damaging 1.000 0.298 phenotype 2015-06-24
33 511255 UTSW D230025D16Rik 0.284 FR4342 222 N 8 105241098 (GRCm38) G207E G A missense Homo probably benign 0.000 2018-04-05
34 511260 UTSW Dbr1 1.000 FR4342 217.47 N 9 99583680 (GRCm38) AGGAGG AGGAGGGGGAGG unclassified Het probably benign phenotype 2018-04-05
35 511251 UTSW Defa29 0.050 FR4342 140.01 N 8 21326144 (GRCm38) R69P C G missense Het probably benign 0.000 2018-04-05
36 511280 UTSW Dhx8 0.969 FR4342 148.47 N 11 101738206 (GRCm38) CG CGAGAACGG frame shift Het probably null phenotype 2018-04-05
37 511289 UTSW Dnah12 0.169 FR4342 222 N 14 26849385 (GRCm38) G2817V G T missense Homo probably damaging 1.000 0.299 2018-04-05
38 324201 UTSW Dnajc22 0.087 R4342 G1 225 Y 15 99104464 (GRCm38) L330* T A nonsense Het probably null 0.976 2015-06-24
39 511232 UTSW Dthd1 0.228 FR4342 214.46 N 5 62843026 (GRCm38) C CTTA small insertion Homo probably benign phenotype 2018-04-05
40 511297 UTSW E4f1 1.000 FR4342 102.47 N 17 24455197 (GRCm38) GC GCCCC unclassified Het probably benign phenotype 2018-04-05
41 324206 UTSW Epas1 1.000 R4342 G1 225 Y 17 86823800 (GRCm38) C336Y G A missense Het probably damaging 1.000 0.953 phenotype 2015-06-24
42 324176 UTSW Evi5l 0.108 R4342 G1 225 Y 8 4183492 (GRCm38) A C utr 5 prime Het probably benign 2015-06-24
43 511303 UTSW F830016B08Rik 0.054 FR4342 214.46 N 18 60299941 (GRCm38) A ACAG small insertion Homo probably benign 2018-04-05
44 511221 UTSW Fam166b 0.090 FR4342 214.46 N 4 43427384 (GRCm38) CAGAG CAG frame shift Homo probably null 2018-04-05
45 324185 UTSW Fam71b 0.000 R4342 G1 225 Y 11 46407216 (GRCm38) D449G A G missense Het possibly damaging 0.672 2015-06-24
46 511233 UTSW Fbrsl1 0.078 FR4342 157.47 N 5 110378125 (GRCm38) GTGTGTGTGCTGGTGCGTGTGCTGGTG GTGTGTGTGCTGGTGTGTGTGCTGGTGCGTGTGCTGGTG small insertion Het probably benign 2018-04-05
47 324182 UTSW Fbxl2 0.000 R4342 G1 225 Y 9 113985306 (GRCm38) H272Q A T missense Het probably benign 0.000 0.071 phenotype 2015-06-24
48 511257 UTSW Fbxo22 0.000 FR4342 98.01 N 9 55221070 (GRCm38) A C splice site 231 bp Het probably null phenotype 2018-04-05
49 324194 UTSW Fgd3 0.129 R4342 G1 225 Y 13 49273709 (GRCm38) C T critical splice donor site 1 bp Het probably null 0.958 2015-06-24
50 324161 UTSW Fhdc1 0.431 R4342 G1 222 Y 3 84444826 (GRCm38) V1031F C A missense Het probably benign 0.418 0.064 2015-06-24
51 511213 UTSW Flg 0.367 FR4342 81.01 N 3 93290513 (GRCm38) G A unclassified Het probably benign phenotype 2018-04-05
52 511204 UTSW Fmn1 0.323 FR4342 214.47 N 2 113525783 (GRCm38) TCC TCCTCCACC small insertion Homo probably benign phenotype 2018-04-05
53 511290 UTSW Frmpd2 0.000 FR4342 222 N 14 33511021 (GRCm38) L399F G T missense Homo probably damaging 1.000 phenotype 2018-04-05
54 324167 UTSW Fscn1 0.470 R4342 G1 225 Y 5 142972021 (GRCm38) Y308H T C missense Het probably damaging 1.000 0.920 phenotype 2015-06-24
55 511219 UTSW Gbp2b 0.000 FR4342 139.01 N 3 142603652 (GRCm38) I175V A G missense Het probably benign 0.002 phenotype 2018-04-05
56 511270 UTSW Gjc2 0.000 FR4342 214.46 N 11 59182743 (GRCm38) T TCCCG unclassified Homo probably benign phenotype 2018-04-05
57 511224 UTSW Gm13103 0.077 FR4342 165.47 N 4 143851643 (GRCm38) AA AATA frame shift Homo probably null 2018-04-05
58 511209 UTSW Gm14496 0.000 FR4342 82.01 N 2 181995906 (GRCm38) K258Q A C missense Het probably benign 0.006 2018-04-05
59 511264 UTSW Gm4340 FR4342 152.47 N 10 104196066 (GRCm38) CAGAAG CAGAAGAAG small insertion Het probably benign 2018-04-05
60 511265 UTSW Gm4340 FR4342 143.47 N 10 104196099 (GRCm38) CAGAAG CAGAAGAAG small insertion Het probably benign 2018-04-05
61 324170 UTSW Gm5878 0.056 R4342 G1 225 Y 6 85125651 (GRCm38) R31* G A nonsense Het probably null 0.976 2015-06-24
62 511222 UTSW Gm7534 0.060 FR4342 214.46 N 4 134202631 (GRCm38) G GCTC small insertion Homo probably benign 2018-04-05
63 324153 UTSW Gm996 0.101 R4342 G1 225 Y 2 25579108 (GRCm38) Y264H A G missense Het possibly damaging 0.915 0.117 2015-06-24
64 511301 UTSW Gpatch11 0.116 FR4342 217.47 N 17 78842178 (GRCm38) AGAGGA AGAGGATGAGGA small insertion Het probably benign 2018-04-05
65 324191 UTSW Gpatch2l 0.000 R4342 G1 225 Y 12 86260679 (GRCm38) V277A T C missense Het probably benign 0.001 0.060 2015-06-24
66 324207 UTSW Greb1l 1.000 R4342 G1 225 Y 18 10544561 (GRCm38) M1385K T A missense Het probably benign 0.115 0.118 2015-06-24
67 324203 UTSW Grin2a 0.582 R4342 G1 225 Y 16 9653589 (GRCm38) I605T A G missense Het possibly damaging 0.518 0.453 phenotype 2015-06-24
68 511300 UTSW H2-Q4 0.056 FR4342 222 N 17 35380405 (GRCm38) D155N G A missense Homo probably damaging 1.000 0.647 phenotype 2018-04-05
69 511285 UTSW Hist1h1t 0.000 FR4342 122.46 N 13 23695913 (GRCm38) TGTGG TG unclassified Homo probably benign phenotype 2018-04-05
70 511236 UTSW Hoxa3 1.000 FR4342 216.23 N 6 52170130 (GRCm38) G GCTT unclassified Homo probably benign phenotype 2018-04-05
71 324202 UTSW Hoxc11 0.852 R4342 G1 225 Y 15 102954671 (GRCm38) S49F C T missense Het probably damaging 1.000 0.257 phenotype 2015-06-24
72 511203 UTSW Ifi208 0.000 FR4342 214.46 N 1 173677698 (GRCm38) ATGGTG ATG small deletion Homo probably benign 2018-04-05
73 324204 UTSW Igf2r 0.918 R4342 G1 225 Y 17 12709511 (GRCm38) E982K C T missense Het possibly damaging 0.955 0.145 phenotype 2015-06-24
74 324193 UTSW Ighv10-3 0.199 R4342 G1 225 Y 12 114523504 (GRCm38) M99K A T missense Het possibly damaging 0.737 0.179 2015-06-24
75 511284 UTSW Ighv5-9 0.312 FR4342 222 N 12 113661877 (GRCm38) S82N C T missense Homo probably benign 0.017 0.090 2018-04-05
76 324190 UTSW Itgb4 1.000 R4342 G1 225 Y 11 115988729 (GRCm38) T614S A T missense Het probably benign 0.007 0.117 phenotype 2015-06-24
77 324199 UTSW Kcnv1 0.000 R4342 G1 225 Y 15 45114444 (GRCm38) T66M G A missense Het probably damaging 1.000 0.906 phenotype 2015-06-24
78 511239 UTSW Klra10 0.057 FR4342 120.01 N 6 130272747 (GRCm38) R192C G A missense Het probably benign 0.008 2018-04-05
79 511243 UTSW Kmt2b 1.000 FR4342 217.47 N 7 30586375 (GRCm38) TCCTCC TCCTCCCCCTCC unclassified Het probably benign phenotype 2018-04-05
80 511277 UTSW Krt10 0.364 FR4342 218.11 N 11 99386199 (GRCm38) CGCC CGCCGCC unclassified Het probably benign phenotype 2018-04-05
81 511278 UTSW Krt10 0.364 FR4342 214.46 N 11 99386203 (GRCm38) ACC ACCCCC unclassified Homo probably benign phenotype 2018-04-05
82 511212 UTSW Lce1m FR4342 108.47 N 3 93018247 (GRCm38) CGCTGCTGCTGCCACAGCA C unclassified Het probably benign 2018-04-05
83 511252 UTSW Mak16 0.969 FR4342 149 N 8 31161749 (GRCm38) E203D T G,A missense Homo probably benign 0.003 2018-04-05
84 324196 UTSW Mast4 0.335 R4342 G1 225 Y 13 102774248 (GRCm38) V461A A G missense Het probably damaging 1.000 0.267 phenotype 2015-06-24
85 324160 UTSW Mcts2 0.932 R4342 G1 225 Y 2 152687664 (GRCm38) V132M G A missense Het probably damaging 1.000 0.647 2015-06-24
86 511210 UTSW Med12l 0.271 FR4342 175.47 N 3 59275988 (GRCm38) AGC AGCGGC small insertion Het probably benign phenotype 2018-04-05
87 511211 UTSW Med12l 0.271 FR4342 168.47 N 3 59275994 (GRCm38) AGCGGC AGCGGCGGC small insertion Het probably benign phenotype 2018-04-05
88 324173 UTSW Mical3 0.173 R4342 G1 225 Y 6 120934838 (GRCm38) E1083* C A nonsense Het probably null 0.976 2015-06-24
89 511234 UTSW Mn1 1.000 FR4342 193.47 N 5 111419706 (GRCm38) AGC AGCGGC small insertion Het probably benign phenotype 2018-04-05
90 511267 UTSW Nacad 0.000 FR4342 217.47 N 11 6599762 (GRCm38) TC TCAGGGGC small insertion Het probably benign 2018-04-05
91 511288 UTSW Naip1 0.000 FR4342 83.01 N 13 100425471 (GRCm38) R1062K C T missense Het probably benign 0.005 phenotype 2018-04-05
92 324181 UTSW Nbeal2 0.261 R4342 G1 225 Y 9 110631793 (GRCm38) A G intron Het probably benign 0.090 phenotype 2015-06-24
93 511271 UTSW Ndel1 1.000 FR4342 225.01 N 11 68833409 (GRCm38) P246L G A missense Het probably damaging 0.966 phenotype 2018-04-05
94 324198 UTSW Nek4 0.387 R4342 G1 225 Y 14 30953906 (GRCm38) V66A T C missense Het probably damaging 1.000 0.643 phenotype 2015-06-24
95 511299 UTSW Nelfe 1.000 FR4342 217.47 N 17 34854089 (GRCm38) AC ACAAAGAGCGGGATCGAGACAGAGCC unclassified Het probably benign phenotype 2018-04-05
96 324151 UTSW Nfasc 1.000 R4342 G1 225 Y 1 132631705 (GRCm38) F229S A G missense Het probably damaging 0.999 0.582 phenotype 2015-06-24
97 324183 UTSW Nhsl1 0.000 R4342 G1 225 Y 10 18526689 (GRCm38) F1221S T C missense Het probably damaging 1.000 0.062 2015-06-24
98 324187 UTSW Nr1d1 0.000 R4342 G1 225 Y 11 98771814 (GRCm38) K118Q T G missense Het probably damaging 0.998 0.156 phenotype 2015-06-24
99 324179 UTSW Ntm 0.140 R4342 G1 225 Y 9 29109431 (GRCm38) E164G T C missense Het probably damaging 0.982 0.225 phenotype 2015-06-24
100 511247 UTSW Olfr495 0.234 FR4342 150.01 N 7 108395893 (GRCm38) T258A A G missense Het probably benign 0.000 phenotype 2018-04-05
[records 1 to 100 of 168] next >> last >|