Incidental Mutations

35 incidental mutations are currently displayed, and affect 35 genes.
3 are Possibly Damaging.
12 are Probably Damaging.
17 are Probably Benign.
3 are Probably Null.
1 create premature stop codons.
0 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 35 of 35] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 325665 UTSW AI481877 0.136 R4364 G1 225 Y 4 59082294 T445P T G missense Het possibly damaging 0.915 0.102 07/06/2015
2 325680 UTSW Amn 1.000 R4364 G1 225 Y 12 111271762 N37H A C missense Het probably damaging 0.993 0.647 phenotype 07/06/2015
3 325674 UTSW Apoa5 0.000 R4364 G1 202 Y 9 46270529 D301V A T missense Het probably damaging 1.000 0.152 phenotype 07/06/2015
4 325661 UTSW Atrn 0.000 R4364 G1 225 Y 2 130970208 E691G A G missense Het probably benign 0.387 0.068 phenotype 07/06/2015
5 325676 UTSW Ccer1 0.061 R4364 G1 121 N 10 97694370 CGAGGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGAGGA small deletion Het probably benign 07/06/2015
6 325678 UTSW Cct2 0.953 R4364 G1 225 Y 10 117055151 V396A A G missense Het probably damaging 0.998 0.477 phenotype 07/06/2015
7 325662 UTSW Dhx35 1.000 R4364 G1 225 Y 2 158842352 Q516* C T nonsense Het probably null 0.976 phenotype 07/06/2015
8 325686 UTSW Dopey2 0.000 R4364 G1 224 Y 16 93770924 K1413R A G missense Het probably benign 0.005 0.071 07/06/2015
9 377800 UTSW Dpp9 1.000 R4364 G1 57 Y 17 56187391 H856R T C missense Het possibly damaging 0.787 0.129 phenotype 04/06/2016
10 325656 UTSW Eif4e2 1.000 R4364 G1 225 Y 1 87224371 F97L T C missense Het probably benign 0.016 0.064 phenotype 07/06/2015
11 325679 UTSW Elmsan1 0.538 R4364 G1 225 Y 12 84156471 G886S C T missense Het probably benign 0.001 0.090 07/06/2015
12 325670 UTSW Exoc6b 0.713 R4364 G1 225 Y 6 85003179 A T intron Het probably benign 0.090 phenotype 07/06/2015
13 325671 UTSW Fat1 1.000 R4364 G1 225 Y 8 44952962 S917T T A missense Het probably benign 0.007 0.117 phenotype 07/06/2015
14 325666 UTSW Frem1 0.762 R4364 G1 225 Y 4 82913251 Y2043N A T missense Het probably damaging 0.992 0.270 phenotype 07/06/2015
15 325687 UTSW Galnt14 0.113 R4364 G1 225 Y 17 73512159 I312T A G missense Het probably damaging 0.985 0.843 phenotype 07/06/2015
16 325677 UTSW Glipr1 0.073 R4364 G1 225 Y 10 111985637 N220S T C missense Het possibly damaging 0.841 0.171 phenotype 07/06/2015
17 325682 UTSW Grid1 0.064 R4364 G1 225 Y 14 34946032 E172G A G missense Het probably benign 0.198 0.142 phenotype 07/06/2015
18 325663 UTSW Hspa4l 0.243 R4364 G1 225 Y 3 40766809 C A splice site Het probably null 0.976 phenotype 07/06/2015
19 325655 UTSW Il1rl2 0.000 R4364 G1 225 Y 1 40351791 R298L G T missense Het probably benign 0.000 0.090 phenotype 07/06/2015
20 325683 UTSW Il7r 0.086 R4364 G1 225 Y 15 9512928 H165L T A missense Het probably damaging 1.000 0.730 phenotype 07/06/2015
21 325685 UTSW Krt83 0.083 R4364 G1 225 N 15 101487514 M326L T G missense Het probably benign 0.000 07/06/2015
22 325657 UTSW Lcn10 0.000 R4364 G1 147 Y 2 25684040 C85F G T missense Het probably damaging 0.999 0.912 phenotype 07/06/2015
23 325669 UTSW Nup205 0.956 R4364 G1 225 Y 6 35192027 P397Q C A missense Het probably benign 0.378 0.090 phenotype 07/06/2015
24 325659 UTSW Olfr1293-ps 0.177 R4364 G1 225 Y 2 111527640 V127M G A missense Het probably benign 0.237 0.110 07/06/2015
25 325689 UTSW Olfr1425 0.070 R4364 G1 205 Y 19 12074497 V45A A G missense Het probably benign 0.127 0.090 phenotype 07/06/2015
26 325673 UTSW Olfr876 0.124 R4364 G1 225 Y 9 37804190 H93L A T missense Het probably benign 0.192 0.090 phenotype 07/06/2015
27 325688 UTSW Prkce 0.000 R4364 G1 225 Y 17 86476851 T218I C T missense Het probably damaging 0.997 0.459 phenotype 07/06/2015
28 325667 UTSW Rhbdl2 0.000 R4364 G1 225 Y 4 123809935 M1K T A start codon destroyed Het probably null 0.865 0.972 phenotype 07/06/2015
29 325681 UTSW Ripor2 0.139 R4364 G1 189 Y 13 24721711 P947S C T missense Het probably benign 0.072 0.090 phenotype 07/06/2015
30 325668 UTSW Shroom3 1.000 R4364 G1 225 Y 5 92943086 V1151F G T missense Het probably damaging 0.997 0.647 phenotype 07/06/2015
31 325660 UTSW Sptbn5 0.275 R4364 G1 205 Y 2 120068655 L428P A G missense Het probably damaging 1.000 0.385 07/06/2015
32 377799 UTSW Syne1 1.000 R4364 G1 225 Y 10 5353987 V789A A G missense Het probably damaging 0.963 0.083 phenotype 04/06/2016
33 325675 UTSW Taar8c 0.099 R4364 G1 225 Y 10 24101579 V112M C T missense Het probably benign 0.024 0.342 07/06/2015
34 325664 UTSW Tex10 0.957 R4364 G1 225 Y 4 48468774 I51V T C missense Het probably benign 0.131 0.071 phenotype 07/06/2015
35 325684 UTSW Ttll1 0.941 R4364 G1 225 Y 15 83499994 Q144L T A missense Het probably damaging 0.988 0.481 phenotype 07/06/2015
[records 1 to 35 of 35]