Incidental Mutations

23 incidental mutations are currently displayed, and affect 23 genes.
1 are Possibly Damaging.
6 are Probably Damaging.
10 are Probably Benign.
5 are Probably Null.
3 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 23 of 23] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 326338 UTSW Abca13 0.000 R4389 G1 225 Y 11 9297878 T2542P A C missense Het probably damaging 0.981 0.647 phenotype 07/06/2015
2 326339 UTSW Adprm 0.000 R4389 G1 191 Y 11 67038193 R324K C T missense Het probably benign 0.002 0.058 07/06/2015
3 371050 UTSW Cd109 0.000 R4389 G1 112 Y 9 78712500 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT critical splice acceptor site Het probably benign 0.090 phenotype 02/09/2016
4 326335 UTSW Cd209b 0.047 R4389 G1 225 Y 8 3925960 L67P A G missense Het probably damaging 0.993 0.435 phenotype 07/06/2015
5 326337 UTSW Cfap54 0.091 R4389 G1 206 Y 10 92967500 K1560M T A missense Het probably benign 0.369 0.090 phenotype 07/06/2015
6 326329 UTSW Ctps 0.947 R4389 G1 225 Y 4 120558790 D212G T C missense Het probably damaging 1.000 0.973 phenotype 07/06/2015
7 326341 UTSW Ercc6 0.510 R4389 G1 225 Y 14 32574908 L1285* T A nonsense Het probably null 0.976 phenotype 07/06/2015
8 326340 UTSW Gzma 0.082 R4389 G1 137 Y 13 113098388 G T splice site Het probably null 0.976 phenotype 07/06/2015
9 326343 UTSW Kng2 0.000 R4389 G1 225 Y 16 23024868 I120M T C missense Het possibly damaging 0.912 0.179 07/06/2015
10 326327 UTSW Lhx3 1.000 R4389 G1 102 Y 2 26201090 C T utr 3 prime Het probably benign phenotype 07/06/2015
11 326330 UTSW Mtfr1l 0.119 R4389 G1 225 Y 4 134532642 T C utr 5 prime Het probably benign 07/06/2015
12 326344 UTSW Ndufb4 0.883 R4389 G1 225 Y 16 37647670 N126S T C missense Het probably benign 0.000 0.090 07/06/2015
13 326334 UTSW Nlrp4e 0.000 R4389 G1 225 N 7 23321227 I380V A G missense Het probably benign 0.006 07/06/2015
14 326336 UTSW Nptn 0.000 R4389 G1 225 Y 9 58643772 K361E A G missense Het probably damaging 1.000 0.853 phenotype 07/06/2015
15 326347 UTSW Olfr262 0.076 R4389 G1 225 Y 19 12241139 V174A A G missense Het probably damaging 0.984 0.207 phenotype 07/06/2015
16 326326 UTSW Orc2 0.953 R4389 G1 225 Y 1 58474861 D332G T C missense Het probably benign 0.210 0.187 phenotype 07/06/2015
17 326346 UTSW Pcdha4 0.155 R4389 G1 225 Y 18 36954789 V675A T C missense Het probably benign 0.000 0.090 phenotype 07/06/2015
18 326342 UTSW Rpl7a-ps3 R4389 G1 120 N 15 36308283 G A exon Het noncoding transcript 07/06/2015
19 326332 UTSW Slc13a1 0.088 R4389 G1 225 Y 6 24092398 A T splice site Het probably null 0.976 phenotype 07/06/2015
20 326331 UTSW Tec 0.070 R4389 G1 224 Y 5 72782007 Y222H A G missense Het probably benign 0.000 0.090 phenotype 07/06/2015
21 326345 UTSW Ttll2 0.155 R4389 G1 154 N 17 7351200 R443* T A nonsense Het probably null 07/06/2015
22 326333 UTSW Vmn1r66 0.059 R4389 G1 225 Y 7 10274788 L106* A T nonsense Het probably null 0.965 07/06/2015
23 326328 UTSW Zfp189 0.000 R4389 G1 225 Y 4 49529934 R346G A G missense Het probably damaging 0.996 0.378 phenotype 07/06/2015
[records 1 to 23 of 23]