Incidental Mutations

43 incidental mutations are currently displayed, and affect 43 genes.
11 are Possibly Damaging.
16 are Probably Damaging.
10 are Probably Benign.
5 are Probably Null.
3 create premature stop codons.
0 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 43 of 43] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 326590 UTSW Atp4b 0.000 R4400 G1 225 N 8 13388810 F189L A G missense Het probably damaging 1.000 phenotype 07/07/2015
2 326578 UTSW Atp8a1 0.000 R4400 G1 225 N 5 67764878 Y372N A T missense Het probably benign 0.127 phenotype 07/07/2015
3 326596 UTSW Bves 0.000 R4400 G1 225 N 10 45369293 V354A T C missense Het probably benign 0.000 phenotype 07/07/2015
4 326600 UTSW Cd79b 0.074 R4400 G1 225 N 11 106312010 Y195* A T nonsense Het probably null phenotype 07/07/2015
5 326573 UTSW Cog6 0.000 R4400 G1 225 N 3 53012941 D131E A C missense Het probably benign 0.110 phenotype 07/07/2015
6 326604 UTSW Elp3 0.954 R4400 G1 225 N 14 65548090 E421K C T missense Het possibly damaging 0.887 phenotype 07/07/2015
7 326595 UTSW Fbxw28 0.062 R4400 G1 225 N 9 109328310 F237Y A T missense Het probably damaging 0.995 07/07/2015
8 326583 UTSW Fezf1 1.000 R4400 G1 225 N 6 23247710 N122S T C missense Het probably benign 0.216 phenotype 07/07/2015
9 326592 UTSW Galnt2 0.092 R4400 G1 225 N 8 124324303 K157E A G missense Het probably damaging 0.997 phenotype 07/07/2015
10 326580 UTSW Git2 0.411 R4400 G1 225 N 5 114733909 E141G T C missense Het possibly damaging 0.938 phenotype 07/07/2015
11 500607 UTSW Gm26888 R4400 G1 222 N 11 119154027 T C synonymous Het silent 12/01/2017
12 326579 UTSW Gnrhr 0.104 R4400 G1 225 N 5 86182249 T C splice site 2307 bp Het probably null phenotype 07/07/2015
13 326569 UTSW Hoxd13 0.508 R4400 G1 225 N 2 74670015 D300V A T missense Het probably damaging 1.000 phenotype 07/07/2015
14 326576 UTSW Hspg2 1.000 R4400 G1 225 N 4 137548122 A2748T G A missense Het probably benign 0.008 phenotype 07/07/2015
15 326594 UTSW Hyal2 1.000 R4400 G1 225 N 9 107570853 N235S A G missense Het probably damaging 1.000 phenotype 07/07/2015
16 326588 UTSW Itgam 0.125 R4400 G1 225 N 7 128081658 L253R T G missense Het probably damaging 1.000 phenotype 07/07/2015
17 326608 UTSW Kcnh8 0.000 R4400 G1 217 N 17 52725906 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA small deletion Het probably benign 0.090 phenotype 07/07/2015
18 326609 UTSW Matr3 0.958 R4400 G1 225 N 18 35583916 K591N A T missense Het possibly damaging 0.801 phenotype 07/07/2015
19 326607 UTSW Mep1a 0.000 R4400 G1 112 N 17 43475006 I731F T A missense Het possibly damaging 0.772 phenotype 07/07/2015
20 326605 UTSW Mkl1 0.683 R4400 G1 225 N 15 81020923 Q103* G A nonsense Het probably null phenotype 07/07/2015
21 326589 UTSW Muc5b 0.168 R4400 G1 225 N 7 141861387 D2690G A G missense Het possibly damaging 0.922 phenotype 07/07/2015
22 500606 UTSW Nlrc5 0.000 R4400 G1 225 N 8 94494353 Q1140R A G missense Het probably benign 0.075 phenotype 12/01/2017
23 326606 UTSW Olfr205 0.102 R4400 G1 225 N 16 59328598 V304I C T missense Het probably benign 0.000 phenotype 07/07/2015
24 326585 UTSW Olfr292 0.065 R4400 G1 225 N 7 86694590 I45V A G missense Het probably benign 0.103 phenotype 07/07/2015
25 326587 UTSW Olfr711 0.054 R4400 G1 225 N 7 106972002 L114P A G missense Het probably damaging 1.000 phenotype 07/07/2015
26 326566 UTSW Plcl1 0.887 R4400 G1 225 N 1 55715577 F1028L T C missense Het probably damaging 0.999 phenotype 07/07/2015
27 326597 UTSW Plpp2 0.000 R4400 G1 225 N 10 79527493 V106A A G missense Het possibly damaging 0.875 phenotype 07/07/2015
28 326598 UTSW Prpf8 0.962 R4400 G1 225 N 11 75490702 T255A A G missense Het possibly damaging 0.630 phenotype 07/07/2015
29 326610 UTSW Shoc2 1.000 R4400 G1 225 N 19 54031229 I568V A G missense Het probably benign 0.024 phenotype 07/07/2015
30 326568 UTSW Spopl 0.000 R4400 G1 225 N 2 23517945 V241M C T missense Het probably damaging 0.972 0.277 phenotype 07/07/2015
31 326571 UTSW Ssrp1 1.000 R4400 G1 225 N 2 85037941 D9V A T missense Het probably damaging 0.970 phenotype 07/07/2015
32 326601 UTSW Strn3 1.000 R4400 G1 225 N 12 51648100 D293E A T missense Het possibly damaging 0.854 07/07/2015
33 326581 UTSW Tbx3 1.000 R4400 G1 160 N 5 119680571 D404Y G T missense Het probably damaging 0.994 phenotype 07/07/2015
34 326575 UTSW Tdrd7 0.483 R4400 G1 225 N 4 46005540 S416P T C missense Het possibly damaging 0.868 phenotype 07/07/2015
35 326591 UTSW Trim60 0.067 R4400 G1 225 N 8 65001212 Y128* G T nonsense Het probably null phenotype 07/07/2015
36 326599 UTSW Tspoap1 0.000 R4400 G1 225 N 11 87775603 S947P T C missense Het probably damaging 1.000 Rimbp2tm1.2Geno does not exacerbate the phenotype of the latter single KO. [provided by MGI curators] (source: MGI)">phenotype 07/07/2015
37 326570 UTSW Ttn 1.000 R4400 G1 225 N 2 76782395 S17113R A T missense Het probably damaging 0.998 phenotype 07/07/2015
38 326602 UTSW Ubqln1 0.610 R4400 G1 225 N 13 58193388 N183I T A missense Het probably damaging 0.997 phenotype 07/07/2015
39 326577 UTSW Ubr4 1.000 R4400 G1 225 N 4 139461856 N3917D A G missense Het possibly damaging 0.659 phenotype 07/07/2015
40 326586 UTSW Ucp2 0.136 R4400 G1 225 N 7 100499350 *310W A G makesense Het probably null phenotype 07/07/2015
41 326572 UTSW Wdr76 0.194 R4400 G1 225 N 2 121528833 M218V A G missense Het probably damaging 0.997 07/07/2015
42 326567 UTSW Zranb3 0.155 R4400 G1 225 N 1 127956655 L998R A C missense Het possibly damaging 0.870 07/07/2015
43 326584 UTSW Zxdc 0.122 R4400 G1 98 N 6 90369810 G51E G A missense Het probably damaging 0.996 07/07/2015
[records 1 to 43 of 43]