Incidental Mutations

60 incidental mutations are currently displayed, and affect 59 genes.
8 are Possibly Damaging.
21 are Probably Damaging.
24 are Probably Benign.
6 are Probably Null.
2 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 60 of 60] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 327928 UTSW Abca9 0.000 R4411 G1 225 Y 11 110151955 I423V T C missense Het probably benign 0.003 0.063 phenotype 07/07/2015
2 327890 UTSW Abl2 0.388 R4411 G1 225 Y 1 156630082 V306A T C missense Het possibly damaging 0.856 0.124 phenotype 07/07/2015
3 327934 UTSW Adcy4 0.000 R4411 G1 225 Y 14 55769443 Y1006C T C missense Het probably damaging 1.000 0.965 phenotype 07/07/2015
4 327920 UTSW Adprhl1 0.000 R4411 G1 225 Y 8 13246114 K144E T C missense Het probably benign 0.160 0.099 phenotype 07/07/2015
5 327923 UTSW Arid5b 0.925 R4411 G1 225 Y 10 68096689 R885G T C missense Het probably damaging 1.000 0.532 phenotype 07/07/2015
6 327899 UTSW Atp9a 0.000 R4411 G1 171 Y 2 168661933 V613E A T missense Het probably damaging 0.997 0.972 07/07/2015
7 327929 UTSW Atxn7l1 0.117 R4411 G1 225 Y 12 33194887 G T intron Het probably benign 0.090 07/07/2015
8 327944 UTSW Brd8 1.000 R4411 G1 225 Y 18 34623444 C A unclassified Het probably benign 0.090 phenotype 07/07/2015
9 327901 UTSW Bsnd 0.070 R4411 G1 225 Y 4 106486671 R146H C T missense Het probably benign 0.000 0.090 phenotype 07/07/2015
10 327941 UTSW C4b 0.000 R4411 G1 225 Y 17 34728864 R1659H C T missense Het probably damaging 1.000 0.758 phenotype 07/07/2015
11 327898 UTSW Duox1 0.000 R4411 G1 225 Y 2 122337634 R1080H G A missense Het probably benign 0.303 0.082 phenotype 07/07/2015
12 327914 UTSW Eml2 0.000 R4411 G1 225 Y 7 19182401 T C critical splice donor site 2 bp Het probably null 0.950 07/07/2015
13 327905 UTSW Fbxo44 0.000 R4411 G1 225 Y 4 148153608 R221C G A missense Het probably damaging 1.000 0.697 phenotype 07/07/2015
14 327900 UTSW Frem1 0.783 R4411 G1 225 Y 4 82963244 D166G T C missense Het probably damaging 1.000 0.124 phenotype 07/07/2015
15 327893 UTSW Galnt5 0.000 R4411 G1 225 Y 2 57999195 L269P T C missense Het probably benign 0.006 0.099 phenotype 07/07/2015
16 327887 UTSW Gigyf2 0.945 R4411 G1 225 Y 1 87436860 E954G A G missense Het probably damaging 0.999 0.085 phenotype 07/07/2015
17 327936 UTSW Gpc6 0.165 R4411 G1 225 Y 14 117951178 V408A T C missense Het probably benign 0.452 0.333 phenotype 07/07/2015
18 327903 UTSW Hspg2 1.000 R4411 G1 225 Y 4 137562224 T3832A A G missense Het probably benign 0.000 0.090 phenotype 07/07/2015
19 327935 UTSW Ift88 1.000 R4411 G1 225 Y 14 57477979 N493S A G missense Het probably damaging 0.993 0.100 phenotype 07/07/2015
20 327931 UTSW Ighv1-76 0.183 R4411 G1 225 Y 12 115848111 C41S A T missense Het probably damaging 1.000 0.647 07/07/2015
21 377721 UTSW Igkv12-46 0.182 R4411 G1 225 Y 6 69764946 T16I G A missense Het probably benign 0.002 0.090 03/23/2016
22 327908 UTSW Igkv3-9 0.178 R4411 G1 225 Y 6 70588563 V49F G T missense Het probably damaging 0.970 0.647 07/07/2015
23 327912 UTSW Isoc2b 0.151 R4411 G1 225 Y 7 4849434 A T intron Het probably benign 07/07/2015
24 327926 UTSW Lcp2 1.000 R4411 G1 225 Y 11 34087173 T A unclassified Het probably benign phenotype 07/07/2015
25 327911 UTSW Lmntd1 0.060 R4411 G1 225 Y 6 145427277 A G critical splice donor site 2 bp Het probably null 0.949 07/07/2015
26 327924 UTSW Mdm2 1.000 R4411 G1 225 Y 10 117709789 A T splice site Het probably null 0.976 phenotype 07/07/2015
27 327917 UTSW Mrgprx3-ps 0.283 R4411 G1 225 Y 7 47309998 T C exon Het noncoding transcript 0.087 07/07/2015
28 327943 UTSW Msh2 0.737 R4411 G1 225 Y 17 87717604 S637P T C missense Het probably damaging 0.966 0.470 phenotype 07/07/2015
29 327947 UTSW Myo5b 0.690 R4411 G1 225 Y 18 74698274 F765S T C missense Het possibly damaging 0.895 0.289 phenotype 07/07/2015
30 327918 UTSW Nav2 0.659 R4411 G1 225 Y 7 49398109 N91K T A missense Het probably benign 0.371 0.066 phenotype 07/07/2015
31 327892 UTSW Ndor1 0.937 R4411 G1 225 Y 2 25248480 P363S G A missense Het probably benign 0.077 0.062 phenotype 07/07/2015
32 327937 UTSW Npr3 0.564 R4411 G1 186 Y 15 11905149 T164R G C missense Het probably benign 0.015 0.090 phenotype 07/07/2015
33 327945 UTSW Pcdhb5 0.093 R4411 G1 225 Y 18 37321997 S477P T C missense Het possibly damaging 0.796 0.179 phenotype 07/07/2015
34 327919 UTSW Pde3b 0.000 R4411 G1 110 N 7 114534749 GTGATGATGATGATGATGATGATGATG GTGATGATGATGATGATGATGATG small deletion Het probably benign phenotype 07/07/2015
35 327891 UTSW Pnpla7 0.133 R4411 G1 225 Y 2 25051704 W13* G A nonsense Het probably null 0.976 phenotype 07/07/2015
36 327930 UTSW Pnpla8 0.251 R4411 G1 225 Y 12 44283442 V41A T C missense Het probably benign 0.003 0.059 phenotype 07/07/2015
37 327904 UTSW Prdm2 0.000 R4411 G1 225 Y 4 143133670 S1017T A T missense Het probably benign 0.177 0.075 phenotype 07/07/2015
38 327907 UTSW Prdm5 0.000 R4411 G1 225 Y 6 65901787 Y108* T A nonsense Het probably null 0.975 phenotype 07/07/2015
39 327927 UTSW Rab34 1.000 R4411 G1 165 Y 11 78188766 T A unclassified Het probably null 0.976 phenotype 07/07/2015
40 327938 UTSW Smpd5 0.136 R4411 G1 225 Y 15 76294912 R160L G T missense Het possibly damaging 0.746 0.179 07/07/2015
41 327940 UTSW Srrm2 0.949 R4411 G1 225 Y 17 23810468 A G unclassified Het probably benign 0.085 07/07/2015
42 327948 UTSW Taf5 0.967 R4411 G1 225 Y 19 47071014 V199D T A missense Het probably damaging 1.000 0.209 phenotype 07/07/2015
43 327909 UTSW Tas2r114 0.059 R4411 G1 225 Y 6 131689622 V148I C T missense Het probably benign 0.058 0.090 phenotype 07/07/2015
44 327910 UTSW Tas2r136 0.058 R4411 G1 225 Y 6 132778009 V52L C A missense Het probably damaging 0.996 0.515 phenotype 07/07/2015
45 327946 UTSW Tex43 0.090 R4411 G1 225 Y 18 56594648 T65A A G missense Het probably benign 0.032 0.090 07/07/2015
46 327906 UTSW Tnfrsf25 0.000 R4411 G1 225 Y 4 152118386 G A unclassified Het probably benign phenotype 07/07/2015
47 327922 UTSW Tpd52l1 0.000 R4411 G1 225 Y 10 31379319 T11A T C missense Het possibly damaging 0.880 0.106 phenotype 07/07/2015
48 327889 UTSW Trmt1l 0.000 R4411 G1 225 Y 1 151452154 E472K G A missense Het probably benign 0.023 0.101 phenotype 07/07/2015
49 327897 UTSW Ttc17 0.738 R4411 G1 225 Y 2 94342753 K766E T C missense Het probably damaging 0.969 0.065 07/07/2015
50 327933 UTSW Ttc37 0.598 R4411 G1 225 Y 13 76127504 E410G A G missense Het possibly damaging 0.893 0.121 phenotype 07/07/2015
51 327895 UTSW Ttn 1.000 R4411 G1 225 Y 2 76730289 R29256Q C T missense Het probably damaging 0.987 0.647 phenotype 07/07/2015
52 327896 UTSW Ttn 1.000 R4411 G1 225 Y 2 76742070 I26160V T C missense Het probably damaging 0.977 0.162 phenotype 07/07/2015
53 327942 UTSW Ubxn6 0.175 R4411 G1 225 Y 17 56069303 V311E A T missense Het probably damaging 1.000 0.584 07/07/2015
54 327921 UTSW Usp2 0.000 R4411 G1 225 Y 9 44091063 S351P T C missense Het probably damaging 0.998 0.187 phenotype 07/07/2015
55 327939 UTSW Usp7 1.000 R4411 G1 225 Y 16 8708914 D187Y C A missense Het probably damaging 1.000 0.508 phenotype 07/07/2015
56 327915 UTSW Vmn1r115 0.075 R4411 G1 155 Y 7 20844282 R235K C T missense Het probably benign 0.012 0.552 07/07/2015
57 327913 UTSW Vmn2r50 0.118 R4411 G1 161 N 7 10050308 F80V A C missense Het probably damaging 0.988 07/07/2015
58 327916 UTSW Vmn2r58 0.472 R4411 G1 225 Y 7 41861936 K481M T A missense Het possibly damaging 0.852 0.179 07/07/2015
59 327925 UTSW Vmn2r86 0.067 R4411 G1 225 N 10 130452600 I344T A G missense Het possibly damaging 0.671 07/07/2015
60 327932 UTSW Zfp455 0.510 R4411 G1 225 Y 13 67207325 N219I A T missense Het probably damaging 0.965 0.647 07/07/2015
[records 1 to 60 of 60]