Incidental Mutations

173 incidental mutations are currently displayed, and affect 147 genes.
12 are Possibly Damaging.
22 are Probably Damaging.
122 are Probably Benign.
16 are Probably Null.
3 create premature stop codons.
3 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 173] next >> last >| per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 511438 UTSW 2010300C02Rik 0.000 FR4449 222 N 1 37625035 E594V T A missense Homo probably benign 0.399 04/05/2018
2 511439 UTSW 2010300C02Rik 0.000 FR4449 222 N 1 37625036 E594* C A nonsense Homo probably null 04/05/2018
3 511505 UTSW 4932415D10Rik 0.080 FR4449 190.46 N 10 82285469 TTCAGT TT frame shift Homo probably null 04/05/2018
4 511466 UTSW Akap9 0.402 FR4449 215.1 N 5 3981214 GGTATTGCATTTCTTATCT G unclassified Homo probably benign phenotype 04/05/2018
5 511489 UTSW Amfr 0.711 FR4449 222 N 8 94005159 G30R C G missense Homo probably damaging 1.000 phenotype 04/05/2018
6 511529 UTSW Anxa7 0.121 FR4449 222 N 14 20469411 G113E C T missense Homo probably damaging 0.967 0.647 phenotype 04/05/2018
7 511554 UTSW Apc 0.968 FR4449 217.47 N 18 34282000 AATAAAGC AATAAAGCCGATAAAGC intron Het probably benign phenotype 04/05/2018
8 511555 UTSW Apc 0.968 FR4449 217.47 N 18 34282005 AGC AGCCAATAACGC intron Het probably benign phenotype 04/05/2018
9 511534 UTSW Apol6 0.058 FR4449 214.46 N 15 77051443 TTT TTTGATT nonsense Homo probably null phenotype 04/05/2018
10 328904 UTSW Arfgap3 0.209 R4449 G1 225 Y 15 83334558 Y105N A T missense Het probably damaging 1.000 0.964 phenotype 07/21/2015
11 511538 UTSW Arid1b 0.735 FR4449 102.47 N 17 4995589 CGG CGGTGG small insertion Het probably benign phenotype 04/05/2018
12 328889 UTSW Arid3b 1.000 R4449 G1 225 Y 9 57798121 K266* T A nonsense Het probably null 0.976 phenotype 07/21/2015
13 511528 UTSW B430218F22Rik 0.095 FR4449 215.1 N 13 118386851 CGGCG CGGCGATGGCG small insertion Homo probably benign 04/05/2018
14 328891 UTSW Bend3 1.000 R4449 G1 225 Y 10 43512083 E824G A G missense Het possibly damaging 0.904 0.061 07/21/2015
15 511483 UTSW Blm 1.000 FR4449 176.47 N 7 80512908 CCTCCTCCTCCTCCTCCTCCTCCT CCTCCTCCTCCTTCTCCTCCTCCTCCTCCTCCTCCT small insertion Het probably benign phenotype 04/05/2018
16 328866 UTSW Bpifb6 0.054 R4449 G1 225 Y 2 153906768 E228G A G missense Het possibly damaging 0.558 0.179 07/21/2015
17 511546 UTSW Brd2 1.000 FR4449 217.47 N 17 34116336 CTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA CAAAAAAAAAAAAAAA unclassified Het probably benign phenotype 04/05/2018
18 511511 UTSW Btnl10 0.079 FR4449 214.46 N 11 58923928 AAG AAGGAG small insertion Homo probably benign 04/05/2018
19 511486 UTSW Cacna1a 0.920 FR4449 217.47 N 8 84638714 ACC ACCCCC small insertion Het probably benign phenotype 04/05/2018
20 511487 UTSW Cacna1a 0.920 FR4449 217.47 N 8 84638720 ACC ACCCCC small insertion Het probably benign phenotype 04/05/2018
21 511488 UTSW Cacna1a 0.920 FR4449 217.47 N 8 84638723 ACC ACCGCC small insertion Het probably benign phenotype 04/05/2018
22 328888 UTSW Cadm1 0.000 R4449 G1 225 Y 9 47813988 T A intron Het probably benign phenotype 07/21/2015
23 377707 UTSW Cadm1 0.000 R4449 G1 64 Y 9 47530437 A22V C T missense Het possibly damaging 0.845 0.061 phenotype 03/21/2016
24 511562 UTSW Calhm1 0.000 FR4449 217.47 N 19 47141274 TGGC TGGCTGTGGCTGCGGC unclassified Het probably benign phenotype 04/05/2018
25 511495 UTSW Ccdc15 0.142 FR4449 123.47 N 9 37315158 C CTTTAT frame shift Het probably null 04/05/2018
26 511526 UTSW Ccdc85c 0.171 FR4449 141.54 N 12 108274616 CCG CCGACG small insertion Het probably benign phenotype 04/05/2018
27 511525 UTSW Ccnk 1.000 FR4449 217.47 N 12 108202507 TTCCCAC T unclassified Het probably benign phenotype 04/05/2018
28 511527 UTSW Cdhr2 0.067 FR4449 214.49 N 13 54725924 AGTC AGTCGTC small insertion Homo probably benign phenotype 04/05/2018
29 511440 UTSW Cdk15 0.000 FR4449 218 N 1 59257823 A ATCTAAAAGG small insertion Homo probably benign 04/05/2018
30 511557 UTSW Cdx1 0.867 FR4449 217.47 N 18 61019881 GCTG GCTGCTCCTG small insertion Het probably benign phenotype 04/05/2018
31 511485 UTSW Cfap46 0.000 FR4449 118.03 N 7 139638795 T C utr 3 prime Homo probably benign 04/05/2018
32 511468 UTSW Cgref1 0.000 FR4449 107.47 N 5 30933776 TTC TTCGTC unclassified Het probably benign 04/05/2018
33 511469 UTSW Cgref1 0.000 FR4449 162.46 N 5 30933778 CTT CTTATT nonsense Homo probably null 04/05/2018
34 511512 UTSW Cluh 0.236 FR4449 192.47 N 11 74669532 G GACTGAA small insertion Het probably benign phenotype 04/05/2018
35 511516 UTSW Cntnap1 0.509 FR4449 217.47 N 11 101189569 AGCCCC AGCCCCCGCCCC unclassified Het probably benign phenotype 04/05/2018
36 511517 UTSW Cntnap1 0.509 FR4449 217.47 N 11 101189593 AGCC AGCCCCCGCC unclassified Het probably benign phenotype 04/05/2018
37 328895 UTSW Cntrob 0.239 R4449 G1 212 Y 11 69305549 D687Y C A missense Het probably benign 0.286 0.140 phenotype 07/21/2015
38 511449 UTSW Cpne1 0.819 FR4449 126.63 N 2 156073502 CCTACT CCT intron Homo probably benign phenotype 04/05/2018
39 511474 UTSW Cttnbp2 0.000 FR4449 217.47 N 6 18367462 CTGCTG CTGCTGTTGCTG utr 3 prime Het probably benign phenotype 04/05/2018
40 511547 UTSW Cul9 0.319 FR4449 167.47 N 17 46500856 TCC TCCGCC small insertion Het probably benign phenotype 04/05/2018
41 328867 UTSW Dap3 1.000 R4449 G1 130 Y 3 88949878 A T unclassified Het probably benign 0.090 phenotype 07/21/2015
42 511500 UTSW Dbr1 1.000 FR4449 217.47 N 9 99583674 AGGAGG AGGAGGGGGAGG unclassified Het probably benign phenotype 04/05/2018
43 511501 UTSW Dbr1 1.000 FR4449 217.47 N 9 99583686 AGGAGG AGGAGGCGGAGG unclassified Het probably benign phenotype 04/05/2018
44 511502 UTSW Dbr1 1.000 FR4449 217.47 N 9 99583696 GGAGGA GGAGGAAGAGGA unclassified Het probably benign phenotype 04/05/2018
45 328893 UTSW Ddc 1.000 R4449 G1 225 Y 11 11835802 D295G T C missense Het probably damaging 1.000 0.528 phenotype 07/21/2015
46 511518 UTSW Dhx8 0.964 FR4449 214.46 N 11 101738184 AGACCG AGACCGTGACCG small insertion Homo probably benign phenotype 04/05/2018
47 511519 UTSW Dhx8 0.964 FR4449 149.47 N 11 101738190 AGACCGGGACCGGGACCGGGACCGGGAC AGACCGGGACCGGGAC small deletion Het probably benign phenotype 04/05/2018
48 511520 UTSW Dhx8 0.964 FR4449 214.46 N 11 101738194 CG CGAGACAG small insertion Homo probably benign phenotype 04/05/2018
49 511521 UTSW Dhx8 0.964 FR4449 217.47 N 11 101738206 CG CGAGACAG small insertion Het probably benign phenotype 04/05/2018
50 511522 UTSW Dhx8 0.964 FR4449 217.47 N 11 101738207 G GAGACCC small insertion Het probably benign phenotype 04/05/2018
51 511470 UTSW Dspp 0.000 FR4449 217.47 N 5 104178388 CGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAG CGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAG small deletion Het probably benign phenotype 04/05/2018
52 511444 UTSW Dusp10 0.653 FR4449 222 N 1 184037056 C73F G T missense Homo probably damaging 0.996 0.550 phenotype 04/05/2018
53 511462 UTSW Erich3 0.000 FR4449 214.46 N 3 154763513 GA GAGAA unclassified Homo probably benign 04/05/2018
54 511445 UTSW Ermn 0.000 FR4449 217.47 N 2 58048074 CTT CTTGTT unclassified Het probably benign 04/05/2018
55 511506 UTSW Fgd6 0.579 FR4449 131.46 N 10 94044320 GGAT G small deletion Homo probably benign 04/05/2018
56 328884 UTSW Fut10 0.098 R4449 G1 225 Y 8 31236257 Y347N T A missense Het probably damaging 1.000 0.949 07/21/2015
57 511441 UTSW G530012D18Rik 0.163 FR4449 173.43 N 1 85577180 GAGAGAGAGAGAGAGAGACAGAGA GAGAGA small deletion Homo probably benign 04/05/2018
58 328887 UTSW Galnt2 0.157 R4449 G1 225 Y 8 124295377 D14G A G missense Het probably benign 0.039 0.084 phenotype 07/21/2015
59 511461 UTSW Gar1 0.960 FR4449 214.46 N 3 129830704 GCCGCCTCCGCC GCCGCC small deletion Homo probably benign 04/05/2018
60 511459 UTSW Gatad2b 1.000 FR4449 130.47 N 3 90341917 AGAC A small deletion Het probably benign phenotype 04/05/2018
61 511442 UTSW Gigyf2 0.928 FR4449 225.01 N 1 87428585 C T unclassified Het probably benign phenotype 04/05/2018
62 377706 UTSW Gm10722 0.752 R4449 G1 20 Y 9 3001041 Y39S A C missense Het probably benign 0.000 0.090 03/21/2016
63 511548 UTSW Gm16519 0.400 FR4449 214.46 N 17 70929338 A AGAT small insertion Homo probably benign 04/05/2018
64 511507 UTSW Gm4340 FR4449 185.47 N 10 104196082 AGC AGCGGC small insertion Het probably benign 04/05/2018
65 511508 UTSW Gm4340 FR4449 217.47 N 10 104196085 AGC AGCGGC small insertion Het probably benign 04/05/2018
66 511509 UTSW Gm4340 FR4449 212.47 N 10 104196086 GCA GCATCA small insertion Het probably benign 04/05/2018
67 511549 UTSW Gpatch11 0.132 FR4449 217.47 N 17 78842168 AGGAAG AGGAAGCGGAAG small insertion Het probably benign 04/05/2018
68 511550 UTSW Gpatch11 0.132 FR4449 217.47 N 17 78842176 GAAGAG GAAGAGCAAGAG small insertion Het probably benign 04/05/2018
69 511551 UTSW Gpatch11 0.132 FR4449 186.47 N 17 78842181 GG GGCAGACG small insertion Het probably benign 04/05/2018
70 328898 UTSW Helz 0.000 R4449 G1 225 Y 11 107604163 V321A T C missense Het probably benign 0.015 0.059 phenotype 07/21/2015
71 328880 UTSW Hnrnpul1 0.613 R4449 G1 225 Y 7 25722284 T C unclassified Het probably benign 0.133 phenotype 07/21/2015
72 511475 UTSW Hoxa10 0.000 FR4449 87.26 N 6 52234186 Q250L T A missense Homo possibly damaging 0.595 phenotype 04/05/2018
73 328871 UTSW Hsdl2 0.000 R4449 G1 225 Y 4 59617692 I353K T A missense Het possibly damaging 0.607 0.179 07/21/2015
74 511476 UTSW Igkv12-89 0.103 FR4449 214.46 N 6 68835280 GCA GCAGCAGCAACA small insertion Homo probably benign 04/05/2018
75 328879 UTSW Igkv3-2 0.242 R4449 G1 225 Y 6 70698841 A45T G A missense Het probably benign 0.110 0.090 07/21/2015
76 511457 UTSW Igsf10 0.284 FR4449 222 N 3 59319110 R2381C G A missense Homo probably damaging 1.000 04/05/2018
77 511530 UTSW Il17rd 0.000 FR4449 217.47 N 14 27082678 GGC GGCAGC utr 5 prime Het probably benign phenotype 04/05/2018
78 511558 UTSW Ints5 0.357 FR4449 109.01 N 19 8897230 R851Q G A missense Het probably benign 0.099 phenotype 04/05/2018
79 511458 UTSW Isg20l2 0.940 FR4449 217.47 N 3 87931713 AGA AGAGGA unclassified Het probably benign phenotype 04/05/2018
80 511491 UTSW Kcng4 0.000 FR4449 222 N 8 119633519 Y39* G T nonsense Homo probably null 0.975 phenotype 04/05/2018
81 328896 UTSW Kcnh6 0.000 R4449 G1 225 Y 11 106018936 Y429C A G missense Het probably damaging 0.993 0.488 phenotype 07/21/2015
82 511544 UTSW Kifc5b 0.469 FR4449 94.01 N 17 26924217 E321A A C missense Het probably benign 0.000 04/05/2018
83 511479 UTSW Klra2 0.057 FR4449 214.97 N 6 131221846 TCCACAG TCCACAGAAACCCACAG frame shift Homo probably null phenotype 04/05/2018
84 511480 UTSW Kmt2b 1.000 FR4449 217.47 N 7 30586361 CCTCCT CCTCCTGCTCCT unclassified Het probably benign phenotype 04/05/2018
85 511481 UTSW Kmt2b 1.000 FR4449 217.47 N 7 30586366 TCCTCC TCCTCCACCTCC unclassified Het probably benign phenotype 04/05/2018
86 511482 UTSW Kmt2b 1.000 FR4449 217.47 N 7 30586369 TCCTCC TCCTCCCCCTCC unclassified Het probably benign phenotype 04/05/2018
87 511515 UTSW Krt10 0.325 FR4449 214.47 N 11 99389267 ACC ACCACCTCC unclassified Het probably benign phenotype 04/05/2018
88 511564 UTSW Las1l FR4449 217.47 N X 95940832 GA GAGAA small insertion Het probably benign 04/05/2018
89 511460 UTSW Lce1m FR4449 218.92 N 3 93018152 AC ACTGCTGCTGCCGC unclassified Het probably benign 04/05/2018
90 511499 UTSW Leo1 1.000 FR4449 217.47 N 9 75450573 GTACCATGCA G critical splice donor site Het probably benign phenotype 04/05/2018
91 511454 UTSW Lkaaear1 0.053 FR4449 217.47 N 2 181697571 CA CATCTCCAGCTCTA unclassified Het probably benign 04/05/2018
92 328874 UTSW Luzp1 0.868 R4449 G1 225 Y 4 136540863 N132K T A missense Het probably damaging 0.998 0.073 phenotype 07/21/2015
93 511493 UTSW Maml2 0.000 FR4449 214.46 N 9 13621456 ACAGCAGCAGCAACAGCAGCAGCAGCAGCA ACAGCAACAGCAGCAGCAGCAGCA small deletion Homo probably benign 04/05/2018
94 511456 UTSW Med12l 0.274 FR4449 168.47 N 3 59275963 CAG CAGTAG nonsense Het probably null phenotype 04/05/2018
95 511443 UTSW Mgat4e 0.099 FR4449 119.59 N 1 134540997 GTCGTAGTCATCGT GTCGT utr 3 prime Homo probably benign 04/05/2018
96 328886 UTSW Mlycd 0.133 R4449 G1 225 Y 8 119410405 Y455N T A missense Het probably damaging 1.000 0.968 phenotype 07/21/2015
97 511471 UTSW Mn1 1.000 FR4449 189.47 N 5 111419710 GCA GCAACA small insertion Het probably benign phenotype 04/05/2018
98 511561 UTSW Morn4 0.133 FR4449 217.73 N 19 42076109 AGGCAGTGAG AGGCAGTGAGTCTGGCAGTGAG small insertion Het probably benign 04/05/2018
99 328892 UTSW Myl7 1.000 R4449 G1 176 Y 11 5897354 D115N C T missense Het probably damaging 0.999 0.686 phenotype 07/21/2015
100 511477 UTSW Nat8f2 0.000 FR4449 222 N 6 85867686 L231F T A missense Homo possibly damaging 0.838 04/05/2018
[records 1 to 100 of 173] next >> last >|