Incidental Mutations

107 incidental mutations are currently displayed, and affect 106 genes.
18 are Possibly Damaging.
48 are Probably Damaging.
29 are Probably Benign.
11 are Probably Null.
1 create premature stop codons.
4 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 107] next >> last >| per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 345846 UTSW 4930518I15Rik R4604 G1 210 N 2 156857154 C T unclassified Het probably benign 09/25/2015
2 345834 UTSW Abcb6 0.240 R4604 G1 190 N 1 75179877 T81I G A missense Het probably benign 0.000 phenotype 09/25/2015
3 345851 UTSW Acp6 0.173 R4604 G1 225 N 3 97175759 K362R A G missense Het probably benign 0.232 phenotype 09/25/2015
4 345888 UTSW Adam26a 0.000 R4604 G1 225 N 8 43570051 M134T A G missense Het probably benign 0.022 phenotype 09/25/2015
5 345877 UTSW Ankrd27 0.000 R4604 G1 225 N 7 35628490 P812S C T missense Het probably damaging 1.000 09/25/2015
6 500693 UTSW Arl6ip1 0.000 R4604 G1 217 N 7 118121899 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA critical splice donor site Het probably benign 0.064 phenotype 12/01/2017
7 345883 UTSW Atp2a1 1.000 R4604 G1 225 N 7 126448623 R672C G A missense Het probably damaging 0.965 phenotype 09/25/2015
8 345862 UTSW Atxn2 0.761 R4604 G1 225 N 5 121781343 W371C G T missense Het probably damaging 1.000 phenotype 09/25/2015
9 345907 UTSW B3gnt2 0.953 R4604 G1 217 N 11 22836426 T TTCACAAA frame shift Het probably null phenotype 09/25/2015
10 345941 UTSW Btnl6 0.054 R4604 G1 225 N 17 34508461 D365V T A missense Het possibly damaging 0.910 09/25/2015
11 345934 UTSW Ccdc80 0.100 R4604 G1 225 N 16 45095565 L228Q T A missense Het probably damaging 1.000 phenotype 09/25/2015
12 345836 UTSW Cdc42bpa 0.577 R4604 G1 225 N 1 180109194 H718R A G missense Het probably benign 0.002 phenotype 09/25/2015
13 345927 UTSW Cdh18 0.132 R4604 G1 225 N 15 23474368 K775E A G missense Het probably benign 0.049 phenotype 09/25/2015
14 345903 UTSW Cdh23 0.591 R4604 G1 225 N 10 60337666 N1679T T G missense Het possibly damaging 0.932 phenotype 09/25/2015
15 345944 UTSW Cep192 0.000 R4604 G1 225 N 18 67815922 D271E T A missense Het possibly damaging 0.639 09/25/2015
16 345920 UTSW Cfap70 0.086 R4604 G1 225 N 14 20443661 T124K G T missense Het probably benign 0.009 09/25/2015
17 345842 UTSW Ckap5 1.000 R4604 G1 225 N 2 91578131 E890D A T missense Het probably benign 0.003 phenotype 09/25/2015
18 345929 UTSW Col22a1 0.000 R4604 G1 225 N 15 71952339 P569T G T missense Het probably benign 0.358 phenotype 09/25/2015
19 345922 UTSW Colq 0.106 R4604 G1 225 N 14 31545103 L150Q A T missense Het possibly damaging 0.770 phenotype 09/25/2015
20 345852 UTSW Csf1 0.760 R4604 G1 225 N 3 107756962 T C intron 27 bp Het probably null phenotype 09/25/2015
21 345928 UTSW Csmd3 0.000 R4604 G1 225 N 15 48004815 S770T A T missense Het possibly damaging 0.898 09/25/2015
22 345942 UTSW Cul9 0.267 R4604 G1 225 N 17 46530146 V733L C A missense Het probably damaging 0.986 phenotype 09/25/2015
23 345947 UTSW Cyp2c55 0.074 R4604 G1 225 N 19 39031386 D256G A G missense Het possibly damaging 0.824 phenotype 09/25/2015
24 345940 UTSW D17Wsu92e 0.000 R4604 G1 181 N 17 27820315 D7G T C missense Het probably damaging 1.000 09/25/2015
25 345899 UTSW Dclk3 0.290 R4604 G1 225 N 9 111469185 D599V A T missense Het probably damaging 1.000 phenotype 09/25/2015
26 345845 UTSW Defb26 0.091 R4604 G1 225 N 2 152508184 I59F T A missense Het possibly damaging 0.533 09/25/2015
27 345869 UTSW Dnah6 0.141 R4604 G1 225 N 6 73129660 V1646A A G missense Het possibly damaging 0.920 phenotype 09/25/2015
28 345893 UTSW Dnm2 1.000 R4604 G1 225 N 9 21504664 T C critical splice donor site 2 bp Het probably null phenotype 09/25/2015
29 345894 UTSW Dock6 0.356 R4604 G1 225 N 9 21802540 L1867P A G missense Het probably damaging 1.000 phenotype 09/25/2015
30 345926 UTSW Dock9 0.000 R4604 G1 225 N 14 121668459 T93K G T missense Het probably damaging 0.997 09/25/2015
31 345891 UTSW Dync2h1 1.000 R4604 G1 225 N 9 7140995 H1344R T C missense Het probably benign 0.003 phenotype 09/25/2015
32 345858 UTSW Enam 0.742 R4604 G1 225 N 5 88504283 Q1217P A C missense Het possibly damaging 0.931 phenotype 09/25/2015
33 345912 UTSW Fbf1 0.000 R4604 G1 225 N 11 116158922 D91E A T missense Het possibly damaging 0.805 09/25/2015
34 345905 UTSW Fbxo7 0.000 R4604 G1 225 N 10 86046802 W393G T G missense Het probably damaging 1.000 phenotype 09/25/2015
35 345879 UTSW Gab2 0.389 R4604 G1 225 N 7 97304213 T599A A G missense Het probably damaging 0.990 phenotype 09/25/2015
36 345878 UTSW Gfy 0.000 R4604 G1 225 N 7 45177188 I409F T A missense Het possibly damaging 0.765 phenotype 09/25/2015
37 345876 UTSW Gm19345 0.221 R4604 G1 225 N 7 19857508 T A splice site Het probably null 09/25/2015
38 345915 UTSW Gm4787 0.070 R4604 G1 225 N 12 81379213 M57T A G missense Het probably benign 0.171 09/25/2015
39 345865 UTSW Gper1 0.108 R4604 G1 225 N 5 139426725 E275G A G missense Het probably damaging 0.978 phenotype 09/25/2015
40 345895 UTSW Grik4 0.086 R4604 G1 225 N 9 42524586 E803G T C missense Het probably damaging 0.999 phenotype 09/25/2015
41 345853 UTSW Gstm3 0.076 R4604 G1 225 N 3 107968197 P39L G A missense Het possibly damaging 0.728 09/25/2015
42 345850 UTSW Hax1 0.160 R4604 G1 225 N 3 89997460 V142D A T missense Het probably damaging 0.986 phenotype 09/25/2015
43 345848 UTSW Hcn3 0.329 R4604 G1 225 N 3 89150440 I383N A T missense Het probably damaging 0.996 phenotype 09/25/2015
44 470253 UTSW Hdac10 0.000 R4604 G1 225 N 15 89125397 C A critical splice acceptor site Het probably null phenotype 03/08/2017
45 345844 UTSW Hipk3 0.000 R4604 G1 225 N 2 104439329 M505R A C missense Het probably damaging 1.000 phenotype 09/25/2015
46 345918 UTSW Hivep1 0.632 R4604 G1 225 N 13 42159749 P1822S C T missense Het probably benign 0.078 phenotype 09/25/2015
47 345859 UTSW Hsd17b13 0.091 R4604 G1 225 N 5 103956258 H281N G T missense Het unknown phenotype 09/25/2015
48 345874 UTSW Irak2 0.000 R4604 G1 225 N 6 113672887 I222N T A missense Het probably damaging 0.995 phenotype 09/25/2015
49 345933 UTSW Kalrn 0.929 R4604 G1 225 N 16 34513926 L7F G A missense Het possibly damaging 0.457 phenotype 09/25/2015
50 345921 UTSW Kcnma1 0.872 R4604 G1 225 N 14 23309038 A G critical splice donor site 2 bp Het probably null phenotype 09/25/2015
51 345849 UTSW Kcnn3 0.462 R4604 G1 225 N 3 89520420 G T start gained Het probably benign phenotype 09/25/2015
52 345913 UTSW Lamb1 1.000 R4604 G1 225 N 12 31278776 D218A A C missense Het probably damaging 1.000 phenotype 09/25/2015
53 345870 UTSW Lrrtm1 0.000 R4604 G1 225 N 6 77244144 N195Y A T missense Het probably damaging 1.000 phenotype 09/25/2015
54 345898 UTSW Ltf 0.000 R4604 G1 225 N 9 111022341 N72I A T missense Het probably damaging 0.993 phenotype 09/25/2015
55 345931 UTSW Mcm4 1.000 R4604 G1 225 N 16 15629663 I479T A G missense Het probably damaging 0.997 phenotype 09/25/2015
56 345887 UTSW Mfhas1 0.211 R4604 G1 225 N 8 35588610 S80P T C missense Het probably benign 0.001 phenotype 09/25/2015
57 345855 UTSW Mknk1 0.000 R4604 G1 225 N 4 115878027 E364G A G missense Het probably damaging 0.959 phenotype 09/25/2015
58 345854 UTSW Msh4 0.472 R4604 G1 225 N 3 153872283 C458Y C T missense Het probably damaging 0.998 phenotype 09/25/2015
59 345919 UTSW Mtrr 0.000 R4604 G1 225 N 13 68564512 A T splice site Het probably null phenotype 09/25/2015
60 345906 UTSW Myo1a 0.157 R4604 G1 225 N 10 127711138 W356R T C missense Het probably damaging 1.000 phenotype 09/25/2015
61 500691 UTSW Nbea 1.000 R4604 G1 225 N 3 55723648 V2186A A G missense Het probably benign 0.179 phenotype 12/01/2017
62 345867 UTSW Nfe2l3 0.000 R4604 G1 183 N 6 51451012 S185P T C missense Het probably damaging 0.993 phenotype 09/25/2015
63 345902 UTSW Nhsl1 0.000 R4604 G1 225 N 10 18531410 K1397Q A C missense Het probably damaging 0.993 09/25/2015
64 345901 UTSW Nmbr 0.068 R4604 G1 225 N 10 14770164 R261W C T missense Het probably damaging 1.000 phenotype 09/25/2015
65 345847 UTSW Npy2r 0.077 R4604 G1 225 N 3 82541058 S137P A G missense Het probably damaging 1.000 phenotype 09/25/2015
66 345909 UTSW Obscn 0.863 R4604 G1 225 N 11 59080205 G2494D C T missense Het probably damaging 1.000 phenotype 09/25/2015
67 345910 UTSW Obscn 0.863 R4604 G1 225 N 11 59122746 K1092E T C missense Het probably damaging 0.962 phenotype 09/25/2015
68 345841 UTSW Olfr1019 0.139 R4604 G1 225 N 2 85841182 C203Y C T missense Het probably damaging 0.993 phenotype 09/25/2015
69 345946 UTSW Oosp2 0.065 R4604 G1 225 N 19 11649683 I92S A C missense Het probably benign 0.008 09/25/2015
70 345925 UTSW Pcdh9 0.225 R4604 G1 225 N 14 93887180 D518G T C missense Het probably damaging 1.000 phenotype 09/25/2015
71 345839 UTSW Pde11a 0.175 R4604 G1 225 N 2 76337793 T272K G T missense Het possibly damaging 0.893 phenotype 09/25/2015
72 345886 UTSW Plekha2 0.000 R4604 G1 178 N 8 25059835 Q162L T A missense Het probably null 0.998 phenotype 09/25/2015
73 345857 UTSW Prkag2 0.000 R4604 G1 225 N 5 24878734 I84F T A missense Het probably damaging 1.000 phenotype 09/25/2015
74 345930 UTSW Prm2 0.147 R4604 G1 225 N 16 10791749 G T unclassified Het probably benign phenotype 09/25/2015
75 345838 UTSW Prpf40a 1.000 R4604 G1 225 N 2 53142023 C800S A T missense Het probably damaging 0.993 09/25/2015
76 345843 UTSW Prr5l 0.214 R4604 G1 225 N 2 101729448 C158S A T missense Het probably benign 0.440 09/25/2015
77 345873 UTSW Prrt3 0.089 R4604 G1 225 N 6 113498237 C8F C A missense Het possibly damaging 0.827 09/25/2015
78 345875 UTSW Psg25 0.063 R4604 G1 225 N 7 18529803 T32A T C missense Het probably benign 0.055 09/25/2015
79 345872 UTSW Ruvbl1 0.965 R4604 G1 225 N 6 88485905 V337A T C missense Het probably benign 0.000 phenotype 09/25/2015
80 345890 UTSW Sall1 0.954 R4604 G1 225 N 8 89030341 Q1045L T A missense Het probably damaging 1.000 phenotype 09/25/2015
81 345900 UTSW Sec22c 0.053 R4604 G1 225 N 9 121695642 Y25C T C missense Het probably damaging 1.000 phenotype 09/25/2015
82 345916 UTSW Serpina3i 0.054 R4604 G1 225 N 12 104267777 T335S A T missense Het possibly damaging 0.907 09/25/2015
83 345863 UTSW Setd1b 1.000 R4604 G1 130 N 5 123152074 TCCACCACCACCACCACCACCACCA TCCACCACCACCACCACCACCA small deletion Het probably benign phenotype 09/25/2015
84 345932 UTSW Slc12a8 0.000 R4604 G1 225 N 16 33608159 I279N T A missense Het probably damaging 0.995 phenotype 09/25/2015
85 500694 UTSW Slc15a1 0.067 R4604 G1 225 N 14 121489907 T83I G A missense Het probably damaging 1.000 phenotype 12/01/2017
86 345937 UTSW Slc22a3 0.000 R4604 G1 225 N 17 12459771 F222S A G missense Het probably benign 0.380 phenotype 09/25/2015
87 345948 UTSW Sorcs3 0.152 R4604 G1 225 N 19 48693914 T463S A T missense Het probably benign 0.347 phenotype 09/25/2015
88 345897 UTSW Spsb4 0.087 R4604 G1 217 N 9 96995878 A131S C A missense Het probably benign 0.003 09/25/2015
89 345914 UTSW Syne2 0.535 R4604 G1 225 N 12 75967710 E3225G A G missense Het probably damaging 0.993 phenotype 09/25/2015
90 345860 UTSW Tchp 0.000 R4604 G1 225 N 5 114719573 G A splice site Het probably null 09/25/2015
91 345938 UTSW Tekt4 0.100 R4604 G1 225 N 17 25471775 D18E T A missense Het probably benign 0.000 phenotype 09/25/2015
92 500692 UTSW Timm50 1.000 R4604 G1 225 N 7 28311018 V37A A G missense Het probably benign 0.000 phenotype 12/01/2017
93 345871 UTSW Tlx2 0.738 R4604 G1 170 N 6 83068760 *285G A C makesense Het probably null phenotype 09/25/2015
94 345943 UTSW Tmem173 0.000 R4604 G1 225 N 18 35738690 I170F T A missense Het probably damaging 0.970 phenotype 09/25/2015
95 345945 UTSW Tshz1 1.000 R4604 G1 225 N 18 84013374 D970Y C A missense Het probably damaging 1.000 phenotype 09/25/2015
96 345840 UTSW Ttn 1.000 R4604 G1 225 N 2 76870461 V50E A T missense Het probably damaging 0.978 phenotype 09/25/2015
97 345911 UTSW Txndc17 0.906 R4604 G1 225 N 11 72209448 S113T T A missense Het probably benign 0.000 09/25/2015
98 345892 UTSW Tyk2 0.000 R4604 G1 199 N 9 21108009 Y1039C T C missense Het probably damaging 1.000 phenotype 09/25/2015
99 345880 UTSW Ubqln3 0.110 R4604 G1 225 N 7 104142491 S131P A G missense Het probably benign 0.001 phenotype 09/25/2015
100 345866 UTSW Uncx 1.000 R4604 G1 150 N 5 139544082 H30L A T missense Het possibly damaging 0.948 phenotype 09/25/2015
[records 1 to 100 of 107] next >> last >|