Incidental Mutations

93 incidental mutations are currently displayed, and affect 91 genes.
12 are Possibly Damaging.
41 are Probably Damaging.
31 are Probably Benign.
8 are Probably Null.
3 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 93 of 93] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 348901 UTSW 2010111I01Rik 0.099 R4627 G1 225 N 13 63068092 S393P T C missense Het probably benign 0.007 0.078 phenotype 10/08/2015
2 348895 UTSW Adam6a 0.069 R4627 G1 225 N 12 113544949 D314V A T missense Het probably benign 0.000 10/08/2015
3 348881 UTSW Adamts18 0.109 R4627 G1 225 N 8 113773168 W371* C T nonsense Het probably null 0.975 phenotype 10/08/2015
4 348830 UTSW Adamtsl2 1.000 R4627 G1 225 N 2 27093585 L331Q T A missense Het probably damaging 0.994 phenotype 10/08/2015
5 348896 UTSW Akr1c13 0.056 R4627 G1 225 N 13 4197870 V214F G T missense Het probably damaging 1.000 0.640 10/08/2015
6 348844 UTSW Aldoart1 0.941 R4627 G1 225 N 4 72852443 T43A T C missense Het probably benign 0.000 10/08/2015
7 348856 UTSW Alkbh2 0.000 R4627 G1 225 N 5 114124226 E148K C T missense Het probably damaging 0.979 0.223 phenotype 10/08/2015
8 348821 UTSW Ano7 0.000 R4627 G1 225 N 1 93375185 I15T T C missense Het probably benign 0.150 phenotype 10/08/2015
9 348819 UTSW Aox3 0.000 R4627 G1 225 N 1 58125035 T155S A T missense Het probably damaging 0.977 10/08/2015
10 348868 UTSW Ap2a1 0.466 R4627 G1 225 N 7 44904419 V535M C T missense Het probably damaging 0.996 phenotype 10/08/2015
11 348852 UTSW Apbb2 0.000 R4627 G1 225 N 5 66400076 C T splice site Het probably null phenotype 10/08/2015
12 348825 UTSW Astn1 0.120 R4627 G1 225 N 1 158502251 H225Q C A missense Het possibly damaging 0.546 phenotype 10/08/2015
13 348883 UTSW Atm 0.894 R4627 G1 225 N 9 53456506 I2439T A G missense Het possibly damaging 0.785 phenotype 10/08/2015
14 348890 UTSW Atp1b2 0.854 R4627 G1 225 N 11 69601334 I263F T A missense Het probably damaging 0.993 phenotype 10/08/2015
15 348909 UTSW Ccdc184 0.143 R4627 G1 153 N 15 98168757 N148Y A T missense Het probably benign 0.011 0.090 10/08/2015
16 348832 UTSW Cdca7 0.128 R4627 G1 161 N 2 72481861 TGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGA TGAAGAAGAAGAAGAAGAAGAAGAAGAAGA small deletion Het probably benign phenotype 10/08/2015
17 348915 UTSW Cep192 0.000 R4627 G1 225 N 18 67812369 P180R C G missense Het probably benign 0.028 10/08/2015
18 348871 UTSW Cfap46 0.000 R4627 G1 225 N 7 139657281 Y571C T C missense Het probably damaging 0.988 10/08/2015
19 348872 UTSW Cfap46 0.000 R4627 G1 225 N 7 139680927 L85Q A T missense Het probably damaging 1.000 10/08/2015
20 348861 UTSW Chchd6 0.059 R4627 G1 225 N 6 89384660 L226F G A missense Het probably damaging 1.000 10/08/2015
21 348854 UTSW Cnot6l 0.451 R4627 G1 225 N 5 96077211 V541A A G missense Het probably benign 0.050 0.058 10/08/2015
22 348887 UTSW Cobl 0.000 R4627 G1 225 N 11 12251093 E1214G T C missense Het probably damaging 1.000 phenotype 10/08/2015
23 348894 UTSW Cpsf2 0.969 R4627 G1 225 N 12 101989895 R319Q G A missense Het probably benign 0.184 10/08/2015
24 348907 UTSW Csdc2 R4627 G1 225 N 15 81949123 V107A T C missense Het probably benign 0.009 10/08/2015
25 500726 UTSW Csmd1 0.000 R4627 G1 225 N 8 16697917 W273R A G missense Het probably benign 0.002 phenotype 12/01/2017
26 348827 UTSW Diexf 0.965 R4627 G1 225 N 1 193107695 T719A T C missense Het probably benign 0.001 10/08/2015
27 348889 UTSW Dnah2 0.000 R4627 G1 225 N 11 69465376 N2156I T A missense Het probably damaging 1.000 phenotype 10/08/2015
28 348899 UTSW Dsp 1.000 R4627 G1 225 N 13 38168641 Y165C A G missense Het probably benign 0.015 phenotype 10/08/2015
29 348853 UTSW Exoc1 1.000 R4627 G1 225 N 5 76542228 V205A T C missense Het probably benign 0.264 phenotype 10/08/2015
30 348867 UTSW Fam98c 0.072 R4627 G1 225 N 7 29155268 T49A T C missense Het possibly damaging 0.707 10/08/2015
31 348863 UTSW Fbln2 0.000 R4627 G1 204 N 6 91259767 V755L G T missense Het probably damaging 0.998 phenotype 10/08/2015
32 348847 UTSW Fhad1 0.061 R4627 G1 225 N 4 141896468 V1371D A T missense Het possibly damaging 0.465 10/08/2015
33 348870 UTSW Folh1 0.000 R4627 G1 225 N 7 86773252 M59K A T missense Het probably benign 0.004 phenotype 10/08/2015
34 348898 UTSW Foxf2 1.000 R4627 G1 225 N 13 31626888 H270L A T missense Het probably benign 0.402 phenotype 10/08/2015
35 500725 UTSW Gm14401 0.181 R4627 G1 225 N 2 177086316 R65H G A missense Het probably benign 0.000 12/01/2017
36 348851 UTSW Gpn1 0.964 R4627 G1 225 N 5 31498393 Y592* C A nonsense Het probably null phenotype 10/08/2015
37 348824 UTSW Hmcn1 0.000 R4627 G1 225 N 1 150595894 D4903A T G missense Het probably benign 0.112 phenotype 10/08/2015
38 348857 UTSW Hnf1a 0.885 R4627 G1 225 N 5 114955871 R220G T C missense Het probably damaging 0.995 phenotype 10/08/2015
39 348833 UTSW Hoxd10 0.650 R4627 G1 225 N 2 74692292 A105T G A missense Het probably benign 0.000 phenotype 10/08/2015
40 348843 UTSW Kcnd3 0.000 R4627 G1 225 N 3 105658766 A421V C T missense Het probably damaging 1.000 0.147 phenotype 10/08/2015
41 348892 UTSW Kidins220 1.000 R4627 G1 225 N 12 25057042 T1498I C T missense Het possibly damaging 0.892 phenotype 10/08/2015
42 348877 UTSW Klhl2 0.000 R4627 G1 225 N 8 64758191 Y274* G T nonsense Het probably null 10/08/2015
43 348818 UTSW Lmbrd1 1.000 R4627 G1 225 N 1 24705999 Y140C A G missense Het probably damaging 0.999 phenotype 10/08/2015
44 348913 UTSW Mapk8ip3 0.783 R4627 G1 225 N 17 24903293 T706I G A missense Het probably benign 0.000 phenotype 10/08/2015
45 348902 UTSW Mast4 0.257 R4627 G1 107 N 13 103334021 S58A A C missense Het possibly damaging 0.924 phenotype 10/08/2015
46 348822 UTSW Mcm6 1.000 R4627 G1 225 N 1 128351548 D167G T C missense Het probably benign 0.014 phenotype 10/08/2015
47 348846 UTSW Mmachc 0.125 R4627 G1 225 N 4 116703471 S276T A T missense Het probably damaging 0.966 phenotype 10/08/2015
48 348880 UTSW Nfat5 0.909 R4627 G1 225 N 8 107369276 Q1289L A T missense Het probably damaging 0.996 phenotype 10/08/2015
49 348914 UTSW Nlrc4 0.109 R4627 G1 225 N 17 74446628 F253L G T missense Het probably damaging 0.999 phenotype 10/08/2015
50 348826 UTSW Nr1i3 0.000 R4627 G1 225 N 1 171216445 A112E C A missense Het probably benign 0.005 phenotype 10/08/2015
51 348897 UTSW Olfr1367 0.058 R4627 G1 225 N 13 21347464 F179L T C missense Het probably damaging 1.000 phenotype 10/08/2015
52 348873 UTSW Olfr45 0.062 R4627 G1 225 N 7 140691378 S158T T A missense Het probably benign 0.003 phenotype 10/08/2015
53 348860 UTSW Olfr455 0.093 R4627 G1 168 N 6 42538441 T194S T A missense Het possibly damaging 0.460 phenotype 10/08/2015
54 348882 UTSW Olfr853 0.061 R4627 G1 225 N 9 19537673 Q86K G T missense Het possibly damaging 0.863 phenotype 10/08/2015
55 348850 UTSW Orc5 0.951 R4627 G1 225 N 5 22548005 F10L G T missense Het probably benign 0.000 0.058 phenotype 10/08/2015
56 348912 UTSW Pde10a 0.000 R4627 G1 225 N 17 8981652 D779A A C missense Het probably damaging 0.999 phenotype 10/08/2015
57 348845 UTSW Pde4b 0.251 R4627 G1 225 N 4 102601605 L486S T C missense Het probably damaging 1.000 phenotype 10/08/2015
58 348841 UTSW Pex2 1.000 R4627 G1 225 N 3 5561281 I156N A T missense Het probably damaging 0.982 phenotype 10/08/2015
59 348849 UTSW Phtf2 0.000 R4627 G1 225 N 5 20773740 R63Q C T missense Het probably damaging 1.000 10/08/2015
60 348876 UTSW Prag1 0.000 R4627 G1 225 N 8 36103292 Y343C A G missense Het probably damaging 0.996 phenotype 10/08/2015
61 348848 UTSW Prdm16 0.793 R4627 G1 225 N 4 154367240 Y170N A T missense Het probably damaging 0.999 phenotype 10/08/2015
62 348840 UTSW Prpf6 1.000 R4627 G1 225 N 2 181601474 K5T A C missense Het probably damaging 0.959 phenotype 10/08/2015
63 348839 UTSW Ptpn1 0.925 R4627 G1 225 N 2 167967781 K103R A G missense Het probably benign 0.005 phenotype 10/08/2015
64 348836 UTSW Ralgapa2 0.296 R4627 G1 225 N 2 146361453 S1159P A G missense Het possibly damaging 0.881 phenotype 10/08/2015
65 348908 UTSW Rapgef3 0.272 R4627 G1 225 N 15 97758929 D318E G T missense Het probably damaging 0.999 0.647 phenotype 10/08/2015
66 348910 UTSW Ripk4 0.299 R4627 G1 225 N 16 97744026 S474T A T missense Het probably damaging 0.991 phenotype 10/08/2015
67 348900 UTSW Rmi1 0.570 R4627 G1 225 N 13 58409136 R400G A G missense Het probably benign 0.028 phenotype 10/08/2015
68 348828 UTSW Sec16a 0.960 R4627 G1 225 N 2 26429393 V1491A A G missense Het probably damaging 1.000 phenotype 10/08/2015
69 348829 UTSW Sec16a 0.960 R4627 G1 225 N 2 26431068 C T splice site 4914 bp Het probably null phenotype 10/08/2015
70 348842 UTSW Setd7 1.000 R4627 G1 225 N 3 51542665 N113K G T missense Het probably damaging 0.991 phenotype 10/08/2015
71 348875 UTSW Shank2 0.000 R4627 G1 225 N 7 144411424 T1502M C T missense Het probably damaging 1.000 phenotype 10/08/2015
72 348884 UTSW Skor1 0.348 R4627 G1 225 N 9 63145476 C376S A T missense Het probably damaging 0.997 10/08/2015
73 348878 UTSW Slc12a3 0.000 R4627 G1 225 N 8 94329384 L49F A T missense Het probably benign 0.000 phenotype 10/08/2015
74 348885 UTSW Slc35d3 0.239 R4627 G1 225 N 10 19849331 V260M C T missense Het probably damaging 1.000 phenotype 10/08/2015
75 348891 UTSW Slc46a1 0.000 R4627 G1 225 N 11 78466889 V256E T A missense Het probably benign 0.055 phenotype 10/08/2015
76 348864 UTSW Slc6a1 0.156 R4627 G1 225 N 6 114308106 S127P T C missense Het probably benign 0.000 phenotype 10/08/2015
77 348869 UTSW Syngr4 0.090 R4627 G1 225 N 7 45887028 L190P A G missense Het probably damaging 1.000 phenotype 10/08/2015
78 348911 UTSW Tagap 0.148 R4627 G1 225 N 17 7926941 G A splice site 5 bp Het probably null phenotype 10/08/2015
79 348865 UTSW Tamm41 0.932 R4627 G1 225 N 6 115035002 N89K A T missense Het probably benign 0.181 phenotype 10/08/2015
80 348905 UTSW Tbc1d31 0.000 R4627 G1 225 N 15 57967912 M922K T A missense Het probably benign 0.000 10/08/2015
81 348886 UTSW Tbk1 1.000 R4627 G1 225 N 10 121568080 N254S T C missense Het possibly damaging 0.820 phenotype 10/08/2015
82 348858 UTSW Tfec 0.000 R4627 G1 225 N 6 16840479 S140P A G missense Het probably damaging 0.989 phenotype 10/08/2015
83 470294 UTSW Tnrc18 0.661 R4627 G1 225 N 5 142740128 E1802G T C missense Het unknown 03/08/2017
84 348888 UTSW Tom1l2 0.318 R4627 G1 225 N 11 60242707 C T critical splice donor site 1 bp Het probably null phenotype 10/08/2015
85 348906 UTSW Tonsl 1.000 R4627 G1 225 N 15 76637224 K323Q T G missense Het probably damaging 1.000 phenotype 10/08/2015
86 348879 UTSW Tsnaxip1 0.432 R4627 G1 225 N 8 105841407 E268D A T missense Het probably damaging 1.000 10/08/2015
87 348831 UTSW Ttf1 0.936 R4627 G1 225 N 2 29065160 H179N C A missense Het possibly damaging 0.719 10/08/2015
88 348834 UTSW Ttn 1.000 R4627 G1 225 N 2 76726173 S30163G T C missense Het probably damaging 0.998 phenotype 10/08/2015
89 348838 UTSW Ube2c 1.000 R4627 G1 225 N 2 164772173 N143S A G missense Het possibly damaging 0.732 0.769 phenotype 10/08/2015
90 348820 UTSW Ugt1a10 0.109 R4627 G1 131 N 1 88218390 R519Q G A missense Het probably damaging 0.998 10/08/2015
91 348855 UTSW Vmn2r9 0.124 R4627 G1 225 N 5 108847597 Y395C T C missense Het probably damaging 1.000 0.647 10/08/2015
92 348903 UTSW Vwa8 0.000 R4627 G1 225 N 14 79103697 G A critical splice donor site 1 bp Het probably null 10/08/2015
93 348866 UTSW Zfp9 0.386 R4627 G1 225 N 6 118464976 Y242H A G missense Het probably damaging 1.000 10/08/2015
[records 1 to 93 of 93]