Incidental Mutations

87 incidental mutations are currently displayed, and affect 85 genes.
15 are Possibly Damaging.
34 are Probably Damaging.
28 are Probably Benign.
8 are Probably Null.
1 create premature stop codons.
4 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 87 of 87] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 351832 UTSW Aak1 0.547 R4665 G1 225 Y 6 86925077 M76K T A missense Het probably null 0.998 0.783 phenotype 10/08/2015
2 351863 UTSW Abcc4 0.000 R4665 G1 225 Y 14 118529002 I886T A G missense Het probably benign 0.000 0.064 phenotype 10/08/2015
3 351854 UTSW Adam6a 0.064 R4665 G1 225 Y 12 113544372 Y122H T C missense Het possibly damaging 0.639 0.179 10/08/2015
4 351870 UTSW Adgre1 0.187 R4665 G1 225 Y 17 57480947 T905A A G missense Het probably benign 0.204 0.158 phenotype 10/08/2015
5 351819 UTSW Arap2 0.000 R4665 G1 225 Y 5 62669969 F969L A G missense Het possibly damaging 0.955 0.347 phenotype 10/08/2015
6 351797 UTSW Arhgef4 0.000 R4665 G1 196 Y 1 34806032 G1439V G T missense Het possibly damaging 0.893 0.077 phenotype 10/08/2015
7 351842 UTSW Atm 0.893 R4665 G1 225 Y 9 53464229 W2097R A G missense Het probably benign 0.004 0.066 phenotype 10/08/2015
8 351840 UTSW Atmin 1.000 R4665 G1 225 Y 8 116957959 D786G A G missense Het probably damaging 1.000 0.198 phenotype 10/08/2015
9 351871 UTSW AU016765 0.078 R4665 G1 225 Y 17 64519921 T A exon Het noncoding transcript 10/08/2015
10 401864 UTSW Capn1 0.000 R4665 G1 225 Y 19 6011015 N253K A T missense Het probably benign 0.031 0.090 phenotype 07/14/2016
11 351802 UTSW Cdc42bpa 0.451 R4665 G1 225 Y 1 180144565 T527A A G missense Het probably damaging 0.989 0.197 phenotype 10/08/2015
12 351862 UTSW Chmp7 1.000 R4665 G1 225 Y 14 69720955 V255D A T missense Het probably damaging 1.000 0.647 10/08/2015
13 351815 UTSW Cldn12 0.000 R4665 G1 225 Y 5 5508385 F14S A G missense Het probably damaging 1.000 0.700 phenotype 10/08/2015
14 351853 UTSW Cpsf2 0.968 R4665 G1 225 Y 12 101983207 S61P T C missense Het probably damaging 1.000 0.924 10/08/2015
15 351831 UTSW Cpvl 0.120 R4665 G1 225 Y 6 53931933 E282K C T missense Het probably benign 0.005 0.090 phenotype 10/08/2015
16 351816 UTSW Crygn 0.078 R4665 G1 225 Y 5 24751021 T A utr 3 prime Het probably benign phenotype 10/08/2015
17 351812 UTSW Csde1 0.948 R4665 G1 225 Y 3 103047072 T386M C T missense Het probably damaging 1.000 0.228 10/08/2015
18 351825 UTSW Cux1 0.912 R4665 G1 225 Y 5 136286799 T1129I G A missense Het probably damaging 1.000 0.529 phenotype 10/08/2015
19 351813 UTSW Dcaf10 0.000 R4665 G1 225 Y 4 45372769 R394Q G A missense Het possibly damaging 0.919 0.179 10/08/2015
20 401863 UTSW Dhx16 1.000 R4665 G1 63 Y 17 35879943 V11A T C missense Het probably damaging 1.000 0.644 phenotype 07/14/2016
21 351823 UTSW Dnah10 0.000 R4665 G1 225 Y 5 124828472 M4060T T C missense Het possibly damaging 0.951 0.181 phenotype 10/08/2015
22 351807 UTSW Duox1 0.000 R4665 G1 225 Y 2 122319475 P116S C T missense Het probably benign 0.003 0.074 phenotype 10/08/2015
23 351798 UTSW Eif5b 1.000 R4665 G1 225 Y 1 38045712 E880G A G missense Het probably damaging 0.995 0.357 phenotype 10/08/2015
24 351848 UTSW Eml6 0.268 R4665 G1 225 Y 11 29819007 Y67* A T nonsense Het probably null 0.976 10/08/2015
25 401860 UTSW Faim2 0.166 R4665 G1 173 Y 15 99524700 C A critical splice donor site 1 bp Het probably null 0.949 phenotype 07/14/2016
26 401861 UTSW Faim2 0.166 R4665 G1 170 Y 15 99524701 S72R T G missense Het probably benign 0.000 0.060 phenotype 07/14/2016
27 351835 UTSW Fam103a1 0.107 R4665 G1 225 Y 7 81768430 R78W C T missense Het probably damaging 1.000 0.647 10/08/2015
28 351809 UTSW Fam160a1 1.000 R4665 G1 225 Y 3 85730681 W104R A T missense Het probably damaging 1.000 0.605 10/08/2015
29 351841 UTSW Fanca 0.712 R4665 G1 225 Y 8 123268972 T1364A T C missense Het probably damaging 0.991 0.106 phenotype 10/08/2015
30 351822 UTSW Gak 1.000 R4665 G1 225 Y 5 108582960 I860T A G missense Het probably benign 0.000 0.090 phenotype 10/08/2015
31 351817 UTSW Garem2 0.278 R4665 G1 178 Y 5 30114667 R376S C A missense Het probably damaging 0.975 0.081 10/08/2015
32 351860 UTSW Gdf2 0.000 R4665 G1 225 Y 14 33945451 T377A A G missense Het probably damaging 1.000 0.171 phenotype 10/08/2015
33 351837 UTSW Gm2431 0.122 R4665 G1 225 Y 7 142257703 C155S A T missense Het unknown 0.087 10/08/2015
34 351810 UTSW Gm37596 0.256 R4665 G1 225 Y 3 93692469 H198Y G A missense Het probably damaging 1.000 0.911 10/08/2015
35 351869 UTSW Gm5814 0.118 R4665 G1 225 Y 17 47410363 M1V A G start codon destroyed Het probably null 0.928 10/08/2015
36 351836 UTSW Gm5901 0.092 R4665 G1 225 Y 7 105377231 Q69E C G missense Het possibly damaging 0.495 0.100 10/08/2015
37 351849 UTSW Gm9945 0.174 R4665 G1 225 Y 11 53480375 A G unclassified Het probably benign 0.090 10/08/2015
38 351808 UTSW Gmps 0.959 R4665 G1 225 Y 3 64001535 V486A T C missense Het probably benign 0.110 0.064 phenotype 10/08/2015
39 351824 UTSW Gtf2ird1 0.732 R4665 G1 225 Y 5 134383902 E55V T A missense Het probably damaging 1.000 0.287 phenotype 10/08/2015
40 351829 UTSW Hoxa11 0.932 R4665 G1 225 Y 6 52243503 N267Y T A missense Het probably damaging 1.000 0.870 phenotype 10/08/2015
41 351866 UTSW Ifngr2 0.000 R4665 G1 225 Y 16 91560038 H153Q C A missense Het possibly damaging 0.514 0.179 phenotype 10/08/2015
42 401856 UTSW Ift172 1.000 R4665 G1 225 Y 5 31285254 Q190K G T missense Het possibly damaging 0.817 0.133 phenotype 07/14/2016
43 351844 UTSW Iqch 0.060 R4665 G1 225 Y 9 63445571 V899A A G missense Het probably damaging 0.999 0.347 10/08/2015
44 351796 UTSW Lactb2 0.094 R4665 G1 225 Y 1 13647400 E133G T C missense Het probably damaging 1.000 0.320 phenotype 10/08/2015
45 351851 UTSW Lig3 1.000 R4665 G1 225 Y 11 82800250 V110M G A missense Het probably damaging 0.988 0.647 phenotype 10/08/2015
46 351821 UTSW Lin54 0.959 R4665 G1 225 Y 5 100453084 Q262H C A missense Het possibly damaging 0.923 0.187 phenotype 10/08/2015
47 351847 UTSW Lingo3 0.097 R4665 G1 158 Y 10 80835538 T186I G A missense Het probably damaging 0.999 0.647 10/08/2015
48 401855 UTSW Lrrc7 0.783 R4665 G1 217 Y 3 158318408 GAAGTTGTTTGGAGATTCTTATCTTA GA critical splice donor site Het probably benign 0.090 phenotype 07/14/2016
49 351856 UTSW Ly86 0.077 R4665 G1 225 Y 13 37375034 F70I T A missense Het probably damaging 0.979 0.115 phenotype 10/08/2015
50 351873 UTSW Mospd2 0.187 R4665 G1 222 Y X 164947333 S301T A T missense Het probably benign 0.001 0.059 10/08/2015
51 401854 UTSW Mroh2a 0.948 R4665 G1 57 Y 1 88241618 I672L A C missense Het probably benign 0.073 0.078 phenotype 07/14/2016
52 401857 UTSW Myo15 0.000 R4665 G1 225 Y 11 60504879 A T critical splice acceptor site Het probably null 0.950 phenotype 07/14/2016
53 351855 UTSW Nme8 0.093 R4665 G1 225 Y 13 19674435 A78P C G missense Het probably damaging 1.000 0.623 phenotype 10/08/2015
54 351850 UTSW Obscn 0.845 R4665 G1 225 N 11 59124752 V965M C T missense Het probably damaging 0.999 phenotype 10/08/2015
55 351805 UTSW Olfr1122 0.162 R4665 G1 225 Y 2 87387876 I57K T A missense Het probably damaging 1.000 0.496 phenotype 10/08/2015
56 351865 UTSW Parn 0.952 R4665 G1 225 Y 16 13541103 K592E T C missense Het probably benign 0.194 0.063 phenotype 10/08/2015
57 351806 UTSW Pax6 1.000 R4665 G1 225 Y 2 105683998 C A intron Het probably benign phenotype 10/08/2015
58 351858 UTSW Pdcd6 0.000 R4665 G1 120 Y 13 74317206 M1K A T start codon destroyed Het probably null 0.024 0.965 phenotype 10/08/2015
59 351811 UTSW Pex11b 1.000 R4665 G1 225 Y 3 96643835 L198P T C missense Het possibly damaging 0.817 0.179 phenotype 10/08/2015
60 351834 UTSW Phldb3 0.111 R4665 G1 225 Y 7 24611427 A28V C T missense Het probably benign 0.001 0.090 10/08/2015
61 351804 UTSW Pkn3 0.000 R4665 G1 225 Y 2 30085457 C A unclassified Het probably benign phenotype 10/08/2015
62 401862 UTSW Pknox1 1.000 R4665 G1 225 Y 17 31595326 T C critical splice donor site 2 bp Het probably null 0.949 phenotype 07/14/2016
63 351859 UTSW Ptprg 0.000 R4665 G1 225 Y 14 12215288 I1092L A C missense Het possibly damaging 0.896 0.355 phenotype 10/08/2015
64 351846 UTSW Pxylp1 0.000 R4665 G1 225 Y 9 96825285 I281M A C missense Het probably damaging 0.986 0.647 10/08/2015
65 351799 UTSW Retreg2 0.087 R4665 G1 225 Y 1 75144666 L195F G T missense Het probably damaging 0.996 0.074 10/08/2015
66 351795 UTSW Rgs20 0.000 R4665 G1 225 Y 1 5021008 F66L G C missense Het probably benign 0.004 0.061 phenotype 10/08/2015
67 351867 UTSW Ripk4 0.368 R4665 G1 225 Y 16 97755073 V157I C T missense Het probably damaging 0.975 0.298 phenotype 10/08/2015
68 401858 UTSW Ryr2 1.000 R4665 G1 225 Y 13 11750685 T C splice site 4 bp Het probably null 0.976 phenotype 07/14/2016
69 351843 UTSW Scaper 0.581 R4665 G1 225 Y 9 55912055 S125R A T missense Het probably damaging 0.999 0.242 10/08/2015
70 351803 UTSW Sec16a 0.965 R4665 G1 213 Y 2 26412958 C T intron Het probably benign phenotype 10/08/2015
71 351818 UTSW Slc35f6 0.000 R4665 G1 225 Y 5 30655613 L37P T C missense Het probably damaging 0.992 0.859 10/08/2015
72 351833 UTSW Slc6a12 0.000 R4665 G1 225 Y 6 121359013 T A splice site Het probably benign phenotype 10/08/2015
73 351839 UTSW Slc9a5 0.148 R4665 G1 225 Y 8 105368128 K784E A G missense Het probably damaging 0.998 0.152 10/08/2015
74 351828 UTSW Snd1 0.911 R4665 G1 225 Y 6 28707054 V455A T C missense Het probably damaging 1.000 0.557 phenotype 10/08/2015
75 401859 UTSW Ssbp2 0.000 R4665 G1 225 Y 13 91539335 I46L A T missense Het possibly damaging 0.476 0.095 phenotype 07/14/2016
76 351814 UTSW Stil 1.000 R4665 G1 225 Y 4 115041644 D1157G A G missense Het probably benign 0.005 0.090 phenotype 10/08/2015
77 351830 UTSW Tax1bp1 0.138 R4665 G1 225 Y 6 52737131 C271S T A missense Het probably benign 0.001 0.058 phenotype 10/08/2015
78 351868 UTSW Tdrd6 0.000 R4665 G1 225 Y 17 43624116 M2014L T A missense Het probably benign 0.000 0.090 phenotype 10/08/2015
79 351826 UTSW Thsd7a 0.000 R4665 G1 225 Y 6 12337314 T1235S T A missense Het possibly damaging 0.794 0.075 phenotype 10/08/2015
80 351827 UTSW Thsd7a 0.000 R4665 G1 225 Y 6 12504013 I381F T A missense Het possibly damaging 0.899 0.161 phenotype 10/08/2015
81 351820 UTSW Tmprss11d 0.062 R4665 G1 225 Y 5 86309401 D133G T C missense Het probably damaging 1.000 0.904 phenotype 10/08/2015
82 351801 UTSW Tpr 1.000 R4665 G1 225 Y 1 150444399 R2233W C T missense Het probably damaging 0.973 0.606 phenotype 10/08/2015
83 351800 UTSW Ugt1a1 0.859 R4665 G1 217 Y 1 88211984 CAGAGAGAGAGAGA CAGAGAGAGAGA intron Het probably benign phenotype 10/08/2015
84 351872 UTSW Vgll1 0.130 R4665 G1 222 Y X 57092432 R54G A G missense Het possibly damaging 0.930 0.179 phenotype 10/08/2015
85 351845 UTSW Wdr72 0.158 R4665 G1 225 Y 9 74210024 T673A A G missense Het probably benign 0.104 0.060 phenotype 10/08/2015
86 351857 UTSW Zfp169 0.069 R4665 G1 225 Y 13 48490863 C T unclassified Het probably benign 0.623 phenotype 10/08/2015
87 351838 UTSW Zfp319 0.157 R4665 G1 225 Y 8 95325573 G A unclassified Het probably benign 10/08/2015
[records 1 to 87 of 87]