Incidental Mutations

113 incidental mutations are currently displayed, and affect 111 genes.
24 are Possibly Damaging.
39 are Probably Damaging.
37 are Probably Benign.
11 are Probably Null.
1 create premature stop codons.
4 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 113] next >> last >| per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 355957 UTSW A530084C06Rik 0.089 R4700 G1 225 Y 13 31558812 A G utr 5 prime Het probably benign 0.090 10/21/2015
2 355943 UTSW Abca13 0.000 R4700 G1 225 Y 11 9292306 T1390A A G missense Het possibly damaging 0.594 0.075 phenotype 10/21/2015
3 394787 UTSW Abca14 0.000 R4700 G1 225 Y 7 120312705 T A critical splice donor site 2 bp Het probably null 0.950 06/17/2016
4 355951 UTSW Abca8a 0.066 R4700 G1 225 Y 11 110070482 V538G A C missense Het probably damaging 1.000 0.690 10/21/2015
5 355933 UTSW Acy1 0.000 R4700 G1 225 Y 9 106433583 G329R C T missense Het probably benign 0.004 0.090 phenotype 10/21/2015
6 355917 UTSW Adamts17 0.061 R4700 G1 225 Y 7 67041888 C607R T C missense Het probably damaging 0.998 0.888 phenotype 10/21/2015
7 355972 UTSW Adamts20 0.142 R4700 G1 225 Y 15 94394622 C202* A T nonsense Het probably null 0.976 phenotype 10/21/2015
8 355976 UTSW Adcy5 0.207 R4700 G1 225 Y 16 35279216 N712S A G missense Het possibly damaging 0.487 0.081 phenotype 10/21/2015
9 355986 UTSW Ahnak 0.306 R4700 G1 225 Y 19 9004681 K1110E A G missense Het probably benign 0.023 0.086 phenotype 10/21/2015
10 355895 UTSW Anks6 1.000 R4700 G1 225 Y 4 47033127 H578L T A missense Het possibly damaging 0.861 0.179 phenotype 10/21/2015
11 355964 UTSW Appl1 0.172 R4700 G1 225 Y 14 26925971 L626F C A missense Het probably benign 0.005 0.060 phenotype 10/21/2015
12 355937 UTSW Arl1 0.802 R4700 G1 225 Y 10 88730637 A G unclassified Het probably benign phenotype 10/21/2015
13 355971 UTSW Atf4 1.000 R4700 G1 225 Y 15 80257417 I336K T A missense Het probably damaging 1.000 0.464 phenotype 10/21/2015
14 355922 UTSW Atp7b 0.768 R4700 G1 225 Y 8 22000121 S1044T A T missense Het probably benign 0.001 0.177 phenotype 10/21/2015
15 355961 UTSW B020031M17Rik 0.064 R4700 G1 193 Y 13 119949842 Y76C T C missense Het probably benign 0.006 0.090 10/21/2015
16 355926 UTSW Carm1 1.000 R4700 G1 225 Y 9 21587184 N466S A G missense Het probably benign 0.118 0.195 phenotype 10/21/2015
17 355930 UTSW Cbl 0.611 R4700 G1 225 Y 9 44173380 S153P A G missense Het probably damaging 1.000 0.954 phenotype 10/21/2015
18 394788 UTSW Ccdc159 0.000 R4700 G1 225 Y 9 21927731 A G splice site 3 bp Het probably null 0.976 06/17/2016
19 394789 UTSW Cd109 0.000 R4700 G1 217 Y 9 78712500 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT critical splice acceptor site Het probably benign 0.090 phenotype 06/17/2016
20 355903 UTSW Cdc7 1.000 R4700 G1 225 Y 5 106973841 F207L T C missense Het probably benign 0.001 0.058 phenotype 10/21/2015
21 394785 UTSW Celsr2 0.000 R4700 G1 225 Y 3 108397231 R2271G T C missense Het probably benign 0.243 0.287 phenotype 06/17/2016
22 355932 UTSW Cep162 0.152 R4700 G1 225 Y 9 87206862 Q989R T C missense Het probably damaging 1.000 0.128 10/21/2015
23 355916 UTSW Cep89 0.141 R4700 G1 225 Y 7 35438437 T749A A G missense Het probably benign 0.052 0.090 10/21/2015
24 394793 UTSW Clcn5 0.000 R4700 G1 222 Y X 7166352 T C splice site 4 bp Het probably null 0.976 phenotype 06/17/2016
25 355967 UTSW Clu 0.210 R4700 G1 225 Y 14 65979864 Y382F A T missense Het probably benign 0.246 0.286 phenotype 10/21/2015
26 355882 UTSW Cnih4 0.120 R4700 G1 225 Y 1 181166243 A G utr 3 prime Het probably benign 0.090 10/21/2015
27 355881 UTSW Crb1 0.344 R4700 G1 225 Y 1 139198771 L1340P A G missense Het probably damaging 0.957 0.647 phenotype 10/21/2015
28 355928 UTSW D730048I06Rik 0.049 R4700 G1 225 Y 9 35789725 C22S A T missense Het probably damaging 0.976 0.647 10/21/2015
29 355960 UTSW Ddx4 0.760 R4700 G1 225 Y 13 112613735 T421A T C missense Het probably damaging 1.000 0.827 phenotype 10/21/2015
30 355919 UTSW Dennd5a 0.152 R4700 G1 225 Y 7 109921198 E484G T C missense Het probably benign 0.007 0.075 phenotype 10/21/2015
31 355984 UTSW Dsg4 0.750 R4700 G1 225 Y 18 20456908 V372L G T missense Het possibly damaging 0.908 0.132 phenotype 10/21/2015
32 355940 UTSW Dyrk2 0.504 R4700 G1 84 N 10 118868286 D21G T C missense Het probably benign 0.000 phenotype 10/21/2015
33 355889 UTSW E2f1 0.820 R4700 G1 225 Y 2 154564022 G144R C G missense Het probably damaging 1.000 0.628 phenotype 10/21/2015
34 394792 UTSW Epb41l4a 0.000 R4700 G1 211 Y 18 33802507 A T splice site 6 bp Het probably null 0.976 phenotype 06/17/2016
35 355921 UTSW F10 1.000 R4700 G1 225 Y 8 13039621 V67F G T missense Het possibly damaging 0.931 0.179 phenotype 10/21/2015
36 355925 UTSW Fat3 0.452 R4700 G1 225 Y 9 16031173 I1301T A G missense Het probably damaging 1.000 0.139 phenotype 10/21/2015
37 355977 UTSW Filip1l 0.000 R4700 G1 225 Y 16 57570695 T549A A G missense Het probably benign 0.002 0.059 10/21/2015
38 355945 UTSW Flt4 1.000 R4700 G1 225 Y 11 49626444 C A intron Het probably benign 0.090 phenotype 10/21/2015
39 355979 UTSW Fndc1 0.067 R4700 G1 225 Y 17 7771480 T1128I G A missense Het unknown 0.129 10/21/2015
40 355955 UTSW Fos 1.000 R4700 G1 225 Y 12 85476162 S283P T C missense Het probably benign 0.000 0.067 phenotype 10/21/2015
41 355901 UTSW Fryl 0.828 R4700 G1 225 Y 5 73065538 Y1900C T C missense Het possibly damaging 0.880 0.126 phenotype 10/21/2015
42 355886 UTSW Fsip2 0.080 R4700 G1 225 Y 2 82987029 Q4369K C A missense Het probably benign 0.317 0.090 phenotype 10/21/2015
43 355883 UTSW Gad2 0.000 R4700 G1 225 Y 2 22673970 H395L A T missense Het probably damaging 1.000 0.968 phenotype 10/21/2015
44 355934 UTSW Grm2 0.373 R4700 G1 182 Y 9 106653931 I120F T A missense Het probably benign 0.184 0.065 phenotype 10/21/2015
45 394784 UTSW Hjurp 0.914 R4700 G1 112 Y 1 88266524 GT GTT nonsense Het probably null 0.976 06/17/2016
46 355892 UTSW Igsf10 0.306 R4700 G1 225 Y 3 59320330 I1974N A T missense Het probably damaging 0.991 0.499 10/21/2015
47 355907 UTSW Il23r 0.000 R4700 G1 225 Y 6 67473850 N215S T C missense Het probably damaging 0.998 0.696 phenotype 10/21/2015
48 355877 UTSW Jph1 0.811 R4700 G1 225 Y 1 17091704 M245L T A missense Het possibly damaging 0.823 0.059 phenotype 10/21/2015
49 355987 UTSW Loxl4 0.000 R4700 G1 225 Y 19 42607613 H147Y G A missense Het probably benign 0.070 0.369 phenotype 10/21/2015
50 355974 UTSW Lsg1 0.935 R4700 G1 136 Y 16 30565449 I521T A G missense Het probably damaging 0.987 0.481 phenotype 10/21/2015
51 355946 UTSW Ltc4s 0.598 R4700 G1 131 Y 11 50237081 G83R C T missense Het probably damaging 1.000 0.647 phenotype 10/21/2015
52 355878 UTSW Map2 0.780 R4700 G1 225 Y 1 66410637 E173G A G missense Het probably damaging 0.961 0.073 phenotype 10/21/2015
53 355914 UTSW Med29 0.965 R4700 G1 193 Y 7 28386927 D152V T A missense Het possibly damaging 0.809 0.100 phenotype 10/21/2015
54 355913 UTSW Megf8 0.920 R4700 G1 225 Y 7 25363515 D2432G A G missense Het probably damaging 1.000 0.478 phenotype 10/21/2015
55 355953 UTSW Mrpl38 0.943 R4700 G1 225 Y 11 116135152 G A unclassified Het probably benign phenotype 10/21/2015
56 355966 UTSW Myh7 0.892 R4700 G1 225 Y 14 54988321 I521T A G missense Het possibly damaging 0.850 0.934 phenotype 10/21/2015
57 355975 UTSW Mylk 0.000 R4700 G1 225 Y 16 34922435 V1106L G T missense Het probably benign 0.157 0.226 phenotype 10/21/2015
58 355952 UTSW Myo15b 0.072 R4700 G1 225 Y 11 115861935 D753V A T missense Het possibly damaging 0.546 10/21/2015
59 355942 UTSW Myo1g 0.000 R4700 G1 195 Y 11 6516785 T C splice site 2262 bp Het probably null 0.109 phenotype 10/21/2015
60 394790 UTSW Myrfl 0.000 R4700 G1 225 Y 10 116777342 A G critical splice donor site 2 bp Het probably null 0.949 06/17/2016
61 355959 UTSW Naip5 0.127 R4700 G1 225 Y 13 100223414 V438A A G missense Het possibly damaging 0.615 0.179 phenotype 10/21/2015
62 355939 UTSW Nav3 0.000 R4700 G1 225 Y 10 109764935 V1277A A G missense Het probably benign 0.098 0.059 phenotype 10/21/2015
63 355962 UTSW Nek10 0.000 R4700 G1 225 Y 14 14842841 V182E T A missense Het possibly damaging 0.691 0.285 10/21/2015
64 355963 UTSW Ngly1 0.775 R4700 G1 225 Y 14 16281809 V355A T C missense Het probably benign 0.013 0.068 phenotype 10/21/2015
65 355894 UTSW Nol6 0.951 R4700 G1 225 Y 4 41118944 E683G T C missense Het possibly damaging 0.580 0.106 phenotype 10/21/2015
66 355880 UTSW Obsl1 0.296 R4700 G1 225 Y 1 75503441 V487E A T missense Het probably damaging 1.000 0.647 10/21/2015
67 394791 UTSW Oc90 0.075 R4700 G1 225 Y 15 65881505 R322W T A missense Het possibly damaging 0.912 0.074 phenotype 06/17/2016
68 355888 UTSW Olfr1313 0.064 R4700 G1 225 Y 2 112071752 V277A A G missense Het possibly damaging 0.535 0.179 phenotype 10/21/2015
69 355885 UTSW Olfr357 0.110 R4700 G1 225 Y 2 36997503 A231D C A missense Het probably benign 0.011 0.191 phenotype 10/21/2015
70 355918 UTSW Olfr677 0.133 R4700 G1 225 Y 7 105056276 H10L A T missense Het possibly damaging 0.814 0.179 phenotype 10/21/2015
71 355929 UTSW Olfr878 0.196 R4700 G1 225 Y 9 37918921 E93G A G missense Het possibly damaging 0.775 0.329 phenotype 10/21/2015
72 355941 UTSW Osbp2 0.118 R4700 G1 225 Y 11 3712160 H231R T C missense Het probably damaging 0.997 0.716 phenotype 10/21/2015
73 355982 UTSW Pdzph1 0.108 R4700 G1 225 Y 17 58974546 H247R T C missense Het probably damaging 0.984 0.647 10/21/2015
74 355920 UTSW Pidd1 0.000 R4700 G1 225 Y 7 141442249 N209S T C missense Het probably damaging 1.000 0.706 phenotype 10/21/2015
75 355981 UTSW Pknox1 1.000 R4700 G1 225 Y 17 31603312 A351V C T missense Het probably damaging 0.998 0.153 phenotype 10/21/2015
76 355909 UTSW Plxnd1 1.000 R4700 G1 225 Y 6 115958615 V1737F C A missense Het probably damaging 0.997 0.379 phenotype 10/21/2015
77 355973 UTSW Prkdc 0.956 R4700 G1 225 Y 16 15702112 K1138M A T missense Het probably damaging 1.000 0.252 phenotype 10/21/2015
78 355935 UTSW Rad54l2 1.000 R4700 G1 210 Y 9 106754025 D21G T C missense Het possibly damaging 0.845 0.061 phenotype 10/21/2015
79 355970 UTSW Recql4 1.000 R4700 G1 225 Y 15 76708585 C302Y C T missense Het probably damaging 0.999 0.138 phenotype 10/21/2015
80 355915 UTSW Scgb2b6 0.351 R4700 G1 225 Y 7 31619483 T C exon Het noncoding transcript 10/21/2015
81 355954 UTSW Sdc1 0.384 R4700 G1 225 Y 12 8790541 E106G A G missense Het possibly damaging 0.816 0.124 phenotype 10/21/2015
82 355890 UTSW Slc10a5 0.092 R4700 G1 225 Y 3 10335299 Q100H C A missense Het probably damaging 1.000 0.647 10/21/2015
83 355891 UTSW Slc10a5 0.092 R4700 G1 225 Y 3 10335300 Q100P T G missense Het probably damaging 1.000 0.187 10/21/2015
84 394786 UTSW Slc5a9 0.075 R4700 G1 225 Y 4 111890937 L226Q A T missense Het possibly damaging 0.645 0.234 06/17/2016
85 355949 UTSW Slfn1 0.000 R4700 G1 225 Y 11 83121649 V197A T C missense Het probably benign 0.046 0.358 phenotype 10/21/2015
86 355985 UTSW Spire1 0.320 R4700 G1 161 Y 18 67512865 M244V T C missense Het probably benign 0.015 0.090 phenotype 10/21/2015
87 355898 UTSW St3gal3 0.000 R4700 G1 154 Y 4 117960035 V141I C T missense Het probably benign 0.011 0.064 phenotype 10/21/2015
88 355884 UTSW St6galnac4 0.000 R4700 G1 126 Y 2 32587160 G T unclassified Het probably benign 0.090 phenotype 10/21/2015
89 355897 UTSW Svep1 1.000 R4700 G1 225 Y 4 58097323 K1407E T C missense Het possibly damaging 0.707 0.097 phenotype 10/21/2015
90 355936 UTSW Tbc1d32 0.860 R4700 G1 225 Y 10 56224649 C78R A G missense Het probably damaging 0.979 0.104 phenotype 10/21/2015
91 355931 UTSW Tln2 0.209 R4700 G1 225 Y 9 67346527 V754A A G missense Het probably benign 0.029 0.144 phenotype 10/21/2015
92 355896 UTSW Tmeff1 0.330 R4700 G1 225 Y 4 48636869 Y189F A T missense Het possibly damaging 0.860 0.064 10/21/2015
93 355893 UTSW Tmem131l 0.184 R4700 G1 225 Y 3 83899212 A1433T C T missense Het probably benign 0.000 0.060 10/21/2015
94 355899 UTSW Tnfrsf8 0.065 R4700 G1 225 Y 4 145303122 Y36C T C missense Het probably damaging 0.994 0.708 phenotype 10/21/2015
95 355887 UTSW Trp53i11 0.060 R4700 G1 225 Y 2 93199900 R184L G T missense Het probably damaging 0.998 0.681 10/21/2015
96 355948 UTSW Trpv1 0.316 R4700 G1 225 Y 11 73251284 M214L A T missense Het possibly damaging 0.466 0.069 phenotype 10/21/2015
97 355924 UTSW Tsnax 0.760 R4700 G1 225 Y 8 125028794 S132T T A missense Het probably benign 0.223 0.085 phenotype 10/21/2015
98 355904 UTSW Ttc28 0.000 R4700 G1 225 Y 5 111277043 L1547P T C missense Het probably damaging 1.000 0.270 10/21/2015
99 355978 UTSW Ttc3 0.793 R4700 G1 225 Y 16 94439241 A G splice site 4896 bp Het probably null 0.702 10/21/2015
100 355956 UTSW Tubal3 0.152 R4700 G1 225 Y 13 3933514 D431E T A missense Het probably damaging 0.988 0.273 10/21/2015
[records 1 to 100 of 113] next >> last >|