Incidental Mutations

301 incidental mutations are currently displayed, and affect 230 genes.
18 are Possibly Damaging.
46 are Probably Damaging.
199 are Probably Benign.
33 are Probably Null.
9 create premature stop codons.
9 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 301] next >> last >| per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 511718 UTSW 1700001K19Rik 0.063 FR4737 200.47 N 12 110668448 TCT TCTCCT unclassified Het probably benign 04/05/2018
2 511567 UTSW 2010300C02Rik 0.000 FR4737 222 N 1 37625035 E594V T A missense Homo probably benign 0.399 04/05/2018
3 511568 UTSW 2010300C02Rik 0.000 FR4737 222 N 1 37625036 E594* C A nonsense Homo probably null 04/05/2018
4 511589 UTSW 4930402H24Rik 0.000 FR4737 145.47 N 2 130770752 CC CCTGC small insertion Het probably benign phenotype 04/05/2018
5 511690 UTSW 4932415D10Rik 0.089 FR4737 134.46 N 10 82285469 TTCA T small deletion Homo probably benign 04/05/2018
6 511596 UTSW 4932438A13Rik 1.000 FR4737 217.47 N 3 37050754 TTATTAT TTATTATTATTATTACTATTAT critical splice acceptor site Het probably benign phenotype 04/05/2018
7 359306 UTSW A430110L20Rik 0.274 R4737 G1 225 Y 1 181227819 A G exon Het noncoding transcript 11/11/2015
8 511571 UTSW A630001G21Rik 0.087 FR4737 130.46 N 1 85723135 CTGTT CT utr 3 prime Homo probably benign 04/05/2018
9 511575 UTSW Abcb11 0.435 FR4737 222 N 2 69243518 R1221L C A missense Homo probably damaging 0.974 phenotype 04/05/2018
10 511627 UTSW Abcb4 0.000 FR4737 172.46 N 5 8896597 GAAA G small deletion Homo probably benign phenotype 04/05/2018
11 359312 UTSW Acp2 0.832 R4737 G1 225 Y 2 91210723 R419W A T missense Het probably benign 0.257 0.090 phenotype 11/11/2015
12 359316 UTSW Actr5 1.000 R4737 G1 225 Y 2 158628071 N207S A G missense Het probably damaging 1.000 0.611 11/11/2015
13 359329 UTSW Afap1 0.288 R4737 G1 225 Y 5 35961782 V254M G A missense Het probably benign 0.025 0.101 phenotype 11/11/2015
14 511617 UTSW Ahdc1 0.231 FR4737 214.46 N 4 133062759 CT CTCGT small insertion Homo probably benign phenotype 04/05/2018
15 511661 UTSW Alpk3 0.365 FR4737 210.48 N 7 81077762 TCT TCTACT small insertion Het probably benign phenotype 04/05/2018
16 511674 UTSW Amfr 0.649 FR4737 222 N 8 94005159 G30R C G missense Homo probably damaging 1.000 phenotype 04/05/2018
17 511605 UTSW Ankrd35 0.000 FR4737 214.46 N 3 96683849 GC GCTAC utr 3 prime Homo probably benign 04/05/2018
18 511722 UTSW Anxa7 0.126 FR4737 222 N 14 20469411 G113E C T missense Homo probably damaging 0.967 0.647 phenotype 04/05/2018
19 511761 UTSW Apc 0.969 FR4737 219.23 N 18 34281999 CAATAAAGC CAATAAAGCTAATAAAGC intron Homo probably benign phenotype 04/05/2018
20 511733 UTSW Apol6 0.054 FR4737 214.46 N 15 77051442 GTTT GTTTCTTT frame shift Homo probably null phenotype 04/05/2018
21 359296 UTSW Arfgef1 1.000 R4737 G1 225 Y 1 10189611 M544K A T missense Het possibly damaging 0.853 0.671 phenotype 11/11/2015
22 359364 UTSW Arhgap5 1.000 R4737 G1 225 Y 12 52519077 M944L A T missense Het probably benign 0.001 0.069 phenotype 11/11/2015
23 511632 UTSW Arpc1b 0.000 FR4737 128.47 N 5 145126787 GGTGGC GGTGGCGTGGC frame shift Het probably null phenotype 04/05/2018
24 511724 UTSW AY358078 0.083 FR4737 82.26 N 14 51805698 S281L C T missense Homo unknown 04/05/2018
25 511748 UTSW BC051142 0.423 FR4737 172.47 N 17 34460051 CAG CAGAAG unclassified Het probably benign 04/05/2018
26 511749 UTSW BC051142 0.423 FR4737 189.47 N 17 34460068 GCA GCATCA unclassified Het probably benign 04/05/2018
27 511659 UTSW Blm 1.000 FR4737 217.47 N 7 80463771 ACCTGC ACCTGCCTGC frame shift Het probably null phenotype 04/05/2018
28 511660 UTSW Blm 1.000 FR4737 217.47 N 7 80463774 T TACCA frame shift Het probably null phenotype 04/05/2018
29 511572 UTSW Blzf1 0.184 FR4737 105.59 N 1 164303917 TTGT TT frame shift Homo probably null 04/05/2018
30 359363 UTSW Bnip3l-ps 0.262 R4737 G1 225 Y 12 18216772 G A unclassified Het noncoding transcript 11/11/2015
31 511694 UTSW Btnl10 0.064 FR4737 214.46 N 11 58923931 A AAGG small insertion Homo probably benign 04/05/2018
32 511668 UTSW Cacna1a 0.933 FR4737 217.49 N 8 84638720 ACC ACCGCC small insertion Het probably benign phenotype 04/05/2018
33 511669 UTSW Cacna1a 0.933 FR4737 214.46 N 8 84638726 ACC ACCCCC small insertion Homo probably benign phenotype 04/05/2018
34 359298 UTSW Carf 0.000 R4737 G1 225 Y 1 60109318 T58A A G missense Het probably benign 0.001 0.090 phenotype 11/11/2015
35 359383 UTSW Carns1 0.087 R4737 G1 225 Y 19 4170928 A G intron Het probably benign phenotype 11/11/2015
36 511584 UTSW Catsper2 0.140 FR4737 214.46 N 2 121397540 TTC TTCTTTTACTTTGTC utr 3 prime Homo probably benign phenotype 04/05/2018
37 511688 UTSW Ccdc170 0.271 FR4737 188.47 N 10 4561023 ACC ACCTCC small insertion Het probably benign phenotype 04/05/2018
38 511689 UTSW Ccdc170 0.271 FR4737 128.51 N 10 4561029 AC ACCCC small insertion Het probably benign phenotype 04/05/2018
39 511577 UTSW Ccdc73 0.080 FR4737 185.46 N 2 104991840 TAAG T unclassified Homo probably benign 04/05/2018
40 511717 UTSW Ccnk 1.000 FR4737 217.47 N 12 108202507 TTCCCAC T unclassified Het probably benign phenotype 04/05/2018
41 359345 UTSW Ccp110 0.857 R4737 G1 225 Y 7 118724548 I670K T A missense Het possibly damaging 0.956 0.185 phenotype 11/11/2015
42 511583 UTSW Cdan1 1.000 FR4737 225.01 N 2 120724971 V763G A C missense Het probably damaging 0.965 phenotype 04/05/2018
43 511626 UTSW Cdk6 0.000 FR4737 100.01 N 5 3344211 A G start gained Het probably benign phenotype 04/05/2018
44 511763 UTSW Cdx1 0.843 FR4737 217.47 N 18 61019874 TGCTGC TGCTGCCGCTGC small insertion Het probably benign phenotype 04/05/2018
45 511764 UTSW Cdx1 0.843 FR4737 217.47 N 18 61019878 GCTGCT GCTGCTTCTGCT small insertion Het probably benign phenotype 04/05/2018
46 511667 UTSW Cfap46 0.000 FR4737 159.59 N 7 139638930 CCTTCT CCTTCTTCT utr 3 prime Homo probably benign 04/05/2018
47 359334 UTSW Cftr 0.238 R4737 G1 225 Y 6 18299883 D1218E T A missense Het probably benign 0.186 0.090 phenotype 11/11/2015
48 511645 UTSW Chd4 1.000 FR4737 144.47 N 6 125122131 GC GCTCCCCC unclassified Homo probably benign phenotype 04/05/2018
49 359330 UTSW Chrna9 0.128 R4737 G1 225 Y 5 65967871 T52S A T missense Het probably damaging 1.000 0.097 phenotype 11/11/2015
50 359378 UTSW Chst9 0.191 R4737 G1 225 Y 18 15452777 Y243C T C missense Het probably damaging 1.000 0.948 phenotype 11/11/2015
51 359320 UTSW Clk2 0.340 R4737 G1 225 Y 3 89168709 H62L A T missense Het probably benign 0.439 0.090 phenotype 11/11/2015
52 511696 UTSW Cluh 0.279 FR4737 217.49 N 11 74669514 CCCCGAGCC CCCCGAGCCCGAGCC small insertion Het probably benign phenotype 04/05/2018
53 511697 UTSW Cluh 0.279 FR4737 217.47 N 11 74669519 AGCCTG AGCCTGCGCCTG small insertion Het probably benign phenotype 04/05/2018
54 511698 UTSW Cluh 0.279 FR4737 217.47 N 11 74669524 GAGCCT GAGCCTAAGCCT small insertion Het probably benign phenotype 04/05/2018
55 511699 UTSW Cluh 0.279 FR4737 217.47 N 11 74669533 CC CCTGAGGC small insertion Het probably benign phenotype 04/05/2018
56 511708 UTSW Cntnap1 0.607 FR4737 217.47 N 11 101189569 AGCCCC AGCCCCCGCCCC unclassified Het probably benign phenotype 04/05/2018
57 511709 UTSW Cntnap1 0.607 FR4737 217.47 N 11 101189576 GCCCCA GCCCCAACCCCA unclassified Het probably benign phenotype 04/05/2018
58 511710 UTSW Cntnap1 0.607 FR4737 217.47 N 11 101189582 GCCCCA GCCCCACCCCCA unclassified Het probably benign phenotype 04/05/2018
59 511711 UTSW Cntnap1 0.607 FR4737 217.47 N 11 101189590 CCCAGC CCCAGCGCCAGC unclassified Het probably benign phenotype 04/05/2018
60 359337 UTSW Cntnap2 0.000 R4737 G1 193 Y 6 45060317 R10W A T missense Het possibly damaging 0.648 0.179 phenotype 11/11/2015
61 359370 UTSW Cpt1b 1.000 R4737 G1 217 Y 15 89421406 D369N C T missense Het probably benign 0.033 0.157 phenotype 11/11/2015
62 359339 UTSW Crhr2 0.167 R4737 G1 225 Y 6 55091305 H423Q G T missense Het probably damaging 1.000 0.232 phenotype 11/11/2015
63 511751 UTSW Cul9 0.364 FR4737 153.47 N 17 46500846 CTCTTC CTCTTCTTC small insertion Het probably benign phenotype 04/05/2018
64 511752 UTSW Cul9 0.364 FR4737 138.47 N 17 46500858 CTC CTCTTC small insertion Het probably benign phenotype 04/05/2018
65 511657 UTSW Cyth2 0.631 FR4737 225.01 N 7 45813042 S102I C A missense Het possibly damaging 0.900 phenotype 04/05/2018
66 359348 UTSW D8Ertd738e 0.903 R4737 G1 225 Y 8 84249521 I33F T A missense Het probably damaging 0.986 0.710 11/11/2015
67 511684 UTSW Dbr1 1.000 FR4737 217.47 N 9 99583686 AGGAGG AGGAGGCGGAGG unclassified Het probably benign phenotype 04/05/2018
68 511685 UTSW Dbr1 1.000 FR4737 216.47 N 9 99583699 GGAGG GGAGGACGAGG unclassified Het probably benign phenotype 04/05/2018
69 359322 UTSW Dbt 1.000 R4737 G1 225 Y 3 116539132 I200T T C missense Het probably damaging 0.989 0.741 phenotype 11/11/2015
70 359368 UTSW Ddhd1 0.000 R4737 G1 225 Y 14 45628821 A T intron Het probably benign phenotype 11/11/2015
71 359318 UTSW Ddx27 0.967 R4737 G1 225 Y 2 167029299 I480V A G missense Het probably benign 0.372 0.080 phenotype 11/11/2015
72 511712 UTSW Dhx8 0.968 FR4737 215.1 N 11 101738179 GACCGA GACCGATACCGA small insertion Homo probably benign phenotype 04/05/2018
73 511713 UTSW Dhx8 0.968 FR4737 214.47 N 11 101738182 CGAGAC CGAGACGGAGAC small insertion Homo probably benign phenotype 04/05/2018
74 511714 UTSW Dhx8 0.968 FR4737 214.46 N 11 101738189 GAGACC GAGACCCAGACC small insertion Homo probably benign phenotype 04/05/2018
75 511746 UTSW Dnah8 0.500 FR4737 217.47 N 17 30635465 ACTGCCCCT ACT small deletion Het probably benign phenotype 04/05/2018
76 511747 UTSW Dnah8 0.500 FR4737 214.46 N 17 30635477 CCTCCCG C small deletion Homo probably benign phenotype 04/05/2018
77 511612 UTSW Dnajb5 0.183 FR4737 217.47 N 4 42957126 AGGTG A frame shift Het probably null phenotype 04/05/2018
78 359375 UTSW Dpp9 1.000 R4737 G1 225 Y 17 56198970 A C critical splice donor site 2 bp Het probably null 0.975 phenotype 11/11/2015
79 359342 UTSW Dpy19l3 0.141 R4737 G1 225 Y 7 35703501 M562K A T missense Het probably damaging 1.000 0.932 11/11/2015
80 359376 UTSW Dus3l 0.370 R4737 G1 225 Y 17 56767868 L330P T C missense Het probably damaging 1.000 0.940 11/11/2015
81 511574 UTSW Dusp10 0.631 FR4737 222 N 1 184037056 C73F G T missense Homo probably damaging 0.996 0.550 phenotype 04/05/2018
82 511741 UTSW E4f1 1.000 FR4737 207.47 N 17 24455192 CCG CCGACG unclassified Homo probably benign phenotype 04/05/2018
83 359325 UTSW Efcab7 0.000 R4737 G1 225 Y 4 99831568 Q96* C T nonsense Het probably null 0.976 11/11/2015
84 359358 UTSW Egfr 0.904 R4737 G1 225 Y 11 16869231 F254L T C missense Het probably damaging 0.989 0.913 phenotype 11/11/2015
85 511769 UTSW Eif3a 0.970 FR4737 217.48 N 19 60775289 TTA TTATTATA critical splice donor site Het probably benign 04/05/2018
86 359366 UTSW Eml5 0.444 R4737 G1 225 Y 12 98798852 V1566M C T missense Het probably damaging 1.000 0.211 11/11/2015
87 359387 UTSW Entpd7 0.112 R4737 G1 225 Y 19 43691195 Y62* T A nonsense Het probably null 0.976 phenotype 11/11/2015
88 359299 UTSW Erbb4 1.000 R4737 G1 225 Y 1 68343900 M313V T C missense Het probably damaging 0.981 0.098 phenotype 11/11/2015
89 511721 UTSW Fam81b 0.232 FR4737 181.47 N 13 76271319 TTC TTCGTC small insertion Het probably benign 04/05/2018
90 511682 UTSW Fbxo22 0.000 FR4737 96.01 N 9 55209382 R56H G A missense Het probably damaging 0.999 phenotype 04/05/2018
91 511603 UTSW Fcgr1 0.427 FR4737 209.47 N 3 96284504 CTTCT C frame shift Het probably null phenotype 04/05/2018
92 511604 UTSW Fcgr1 0.427 FR4737 80.03 N 3 96287094 D159G T C missense Homo probably benign 0.006 phenotype 04/05/2018
93 511578 UTSW Fmn1 0.318 FR4737 217.47 N 2 113525778 CCTCCT CCTCCTACTCCT small insertion Het probably benign phenotype 04/05/2018
94 511579 UTSW Fmn1 0.318 FR4737 178.47 N 2 113525781 CC CCCCCTGC small insertion Het probably benign phenotype 04/05/2018
95 511580 UTSW Fmn1 0.318 FR4737 217.47 N 2 113525784 CC CCTCCTTC small insertion Het probably benign phenotype 04/05/2018
96 511570 UTSW G530012D18Rik 0.184 FR4737 165.47 N 1 85577178 GA GACAGAGATA frame shift Het probably null 04/05/2018
97 511720 UTSW Gli3 1.000 FR4737 225.01 N 13 15644357 R248H G A missense Het probably damaging 1.000 phenotype 04/05/2018
98 511622 UTSW Gm16503 0.234 FR4737 118.01 N 4 147541253 G68E G A missense Het unknown 04/05/2018
99 511649 UTSW Gm19345 0.250 FR4737 217.54 N 7 19857602 GGATGGCAGGTG GG frame shift Het probably null 04/05/2018
100 511691 UTSW Gm4340 FR4737 202.47 N 10 104196077 GCA GCAACA small insertion Het probably benign 04/05/2018
[records 1 to 100 of 301] next >> last >|