Incidental Mutations

71 incidental mutations are currently displayed, and affect 71 genes.
8 are Possibly Damaging.
29 are Probably Damaging.
24 are Probably Benign.
7 are Probably Null.
3 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 71 of 71] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 356569 UTSW 4930519G04Rik 0.062 R4744 G1 225 Y 5 114879556 S143P T C missense Het possibly damaging 0.827 0.179 11/11/2015
2 356595 UTSW 4933427D14Rik 1.000 R4744 G1 225 Y 11 72175539 K614E T C missense Het probably damaging 0.983 0.073 11/11/2015
3 356598 UTSW Aatk 0.289 R4744 G1 184 Y 11 120016122 M155T A G missense Het possibly damaging 0.645 0.446 phenotype 11/11/2015
4 356589 UTSW Acvr2b 1.000 R4744 G1 214 Y 9 119431262 L333P T C missense Het probably damaging 1.000 0.927 phenotype 11/11/2015
5 356565 UTSW Adam22 1.000 R4744 G1 225 Y 5 8078699 E865G T C missense Het probably damaging 0.979 0.121 phenotype 11/11/2015
6 356573 UTSW Add2 0.259 R4744 G1 225 Y 6 86110888 S358G A G missense Het probably damaging 0.999 0.081 phenotype 11/11/2015
7 356591 UTSW Agap2 0.420 R4744 G1 197 Y 10 127090203 T C critical splice donor site 2 bp Het probably null 0.950 phenotype 11/11/2015
8 356583 UTSW Alkbh8 0.000 R4744 G1 225 Y 9 3344604 W49* G A nonsense Het probably null 0.976 phenotype 11/11/2015
9 356558 UTSW AU015228 0.249 R4744 G1 225 Y 2 130100629 A T exon Het noncoding transcript 0.133 11/11/2015
10 356559 UTSW Bank1 0.081 R4744 G1 225 Y 3 136247689 R102S G T missense Het probably benign 0.115 0.089 phenotype 11/11/2015
11 356571 UTSW Brap 1.000 R4744 G1 225 Y 5 121662130 D27E T A missense Het probably damaging 0.999 0.130 phenotype 11/11/2015
12 356581 UTSW Cyb5r2 0.000 R4744 G1 225 Y 7 107750277 H276N G T missense Het possibly damaging 0.466 0.086 phenotype 11/11/2015
13 397278 UTSW Dhh 0.539 R4744 G1 71 Y 15 98894258 F290L A G missense Het possibly damaging 0.855 0.832 phenotype 07/05/2016
14 356600 UTSW Dhrs7 0.082 R4744 G1 225 Y 12 72652251 N319I T A missense Het possibly damaging 0.941 0.131 phenotype 11/11/2015
15 397277 UTSW Ebpl 0.111 R4744 G1 59 Y 14 61360233 V53A A G missense Het probably damaging 0.997 0.142 07/05/2016
16 356614 UTSW Eif3j2 0.891 R4744 G1 113 Y 18 43477717 TGCCGCCGCCGCCGCCGCCGCCGCCGCC TGCCGCCGCCGCCGCCGCCGCCGCC small deletion Het probably benign 0.090 11/11/2015
17 356576 UTSW Etnk1 0.000 R4744 G1 225 Y 6 143186593 N220T A C missense Het probably damaging 1.000 0.901 phenotype 11/11/2015
18 356547 UTSW F11r 0.111 R4744 G1 225 Y 1 171460598 V64D T A missense Het probably benign 0.005 0.090 phenotype 11/11/2015
19 356548 UTSW Fam171a1 0.128 R4744 G1 225 Y 2 3224909 S360P T C missense Het probably damaging 1.000 0.798 11/11/2015
20 356592 UTSW Fignl1 1.000 R4744 G1 225 Y 11 11801585 M490T A G missense Het probably damaging 0.982 0.222 phenotype 11/11/2015
21 356611 UTSW Fpr-rs7 0.117 R4744 G1 225 Y 17 20114003 M75K A T missense Het probably benign 0.170 0.090 11/11/2015
22 356544 UTSW Fzd7 0.479 R4744 G1 225 Y 1 59484436 F493I T A missense Het possibly damaging 0.722 0.147 phenotype 11/11/2015
23 356612 UTSW Galnt14 0.102 R4744 G1 225 Y 17 73507833 P412T G T missense Het probably damaging 1.000 0.647 phenotype 11/11/2015
24 356552 UTSW Gcg 0.211 R4744 G1 225 Y 2 62478631 S60C T A missense Het probably damaging 1.000 0.727 phenotype 11/11/2015
25 356590 UTSW Ggt1 0.099 R4744 G1 225 Y 10 75585899 K527E A G missense Het probably benign 0.001 0.090 phenotype 11/11/2015
26 356557 UTSW Gm14085 0.078 R4744 G1 225 Y 2 122522805 K489* A T nonsense Het probably null 0.975 11/11/2015
27 356587 UTSW Gm16551 0.157 R4744 G1 225 Y 9 74850871 T A unclassified Het noncoding transcript 0.087 11/11/2015
28 356593 UTSW Gm9972 0.121 R4744 G1 225 Y 11 43036690 K55E A G missense Het unknown 0.087 11/11/2015
29 356602 UTSW Gpr141 0.074 R4744 G1 225 Y 13 19751714 D297V T A missense Het probably benign 0.400 0.090 phenotype 11/11/2015
30 356575 UTSW Grin2b 1.000 R4744 G1 225 Y 6 135778699 S539L G A missense Het probably damaging 0.996 0.333 phenotype 11/11/2015
31 356601 UTSW Hhipl1 0.000 R4744 G1 225 Y 12 108319979 N515I A T missense Het possibly damaging 0.948 0.144 phenotype 11/11/2015
32 356546 UTSW Hmcn1 0.000 R4744 G1 130 Y 1 150577612 E5317D T G missense Het probably damaging 0.998 0.685 phenotype 11/11/2015
33 356597 UTSW Hsf5 0.176 R4744 G1 225 Y 11 87622791 N227K T A missense Het probably benign 0.019 0.090 11/11/2015
34 356545 UTSW Igfn1 0.083 R4744 G1 225 Y 1 135982458 D129E A T missense Het probably benign 0.068 0.090 11/11/2015
35 356560 UTSW Invs 0.796 R4744 G1 225 Y 4 48397609 F339L T C missense Het probably damaging 1.000 0.558 phenotype 11/11/2015
36 356616 UTSW Jak2 1.000 R4744 G1 225 Y 19 29262256 S17T T A missense Het probably benign 0.023 0.061 phenotype 11/11/2015
37 356599 UTSW Mdga2 0.000 R4744 G1 225 Y 12 66797727 I166F T A missense Het probably benign 0.015 0.551 phenotype 11/11/2015
38 356588 UTSW Nck1 0.000 R4744 G1 225 Y 9 100506744 I6V T C missense Het probably benign 0.000 0.090 phenotype 11/11/2015
39 356551 UTSW Neb 0.728 R4744 G1 225 Y 2 52150577 D6624G T C missense Het probably benign 0.295 0.090 phenotype 11/11/2015
40 356594 UTSW Nmur2 0.106 R4744 G1 225 Y 11 56040835 Y17H A G missense Het probably benign 0.011 0.090 phenotype 11/11/2015
41 356566 UTSW Nwd2 0.114 R4744 G1 225 Y 5 63806967 L1298P T C missense Het probably damaging 1.000 0.775 11/11/2015
42 356582 UTSW Ocel1 0.088 R4744 G1 225 Y 8 71372753 E161G A G missense Het probably damaging 1.000 0.596 11/11/2015
43 356550 UTSW Olfr345 0.063 R4744 G1 225 Y 2 36640979 A T unclassified 3 bp Het probably null 0.976 phenotype 11/11/2015
44 356613 UTSW Pabpc2 0.105 R4744 G1 225 Y 18 39774828 Y382C A G missense Het probably benign 0.071 0.119 11/11/2015
45 356584 UTSW Panx1 0.000 R4744 G1 225 Y 9 15010298 A G intron Het probably benign phenotype 11/11/2015
46 356554 UTSW Pdhx 1.000 R4744 G1 225 Y 2 103042296 V147D A T missense Het probably benign 0.012 0.090 phenotype 11/11/2015
47 356609 UTSW Pigz 0.000 R4744 G1 225 Y 16 31945333 H403L A T missense Het probably damaging 1.000 0.890 phenotype 11/11/2015
48 356572 UTSW Pilra 0.065 R4744 G1 225 Y 5 137835507 T C unclassified 4 bp Het probably null 0.400 phenotype 11/11/2015
49 356567 UTSW Rbm47 0.139 R4744 G1 218 Y 5 66026693 D189G T C missense Het probably damaging 0.984 0.904 phenotype 11/11/2015
50 356603 UTSW Rhobtb2 0.000 R4744 G1 225 Y 14 69794002 L558P A G missense Het probably damaging 1.000 0.961 phenotype 11/11/2015
51 356608 UTSW Scarf2 0.000 R4744 G1 225 Y 16 17803516 R322H G A missense Het probably damaging 0.994 0.114 phenotype 11/11/2015
52 356605 UTSW Sept3 0.161 R4744 G1 225 Y 15 82290457 T C critical splice donor site 2 bp Het probably null 0.949 phenotype 11/11/2015
53 356577 UTSW Sirt2 0.000 R4744 G1 225 Y 7 28777013 F26L T C missense Het probably damaging 1.000 0.963 phenotype 11/11/2015
54 356615 UTSW Slc1a1 0.000 R4744 G1 225 Y 19 28894525 T133S A T missense Het probably benign 0.000 0.114 phenotype 11/11/2015
55 356553 UTSW Slc1a2 0.457 R4744 G1 225 Y 2 102737869 I84V A G missense Het probably benign 0.411 0.410 phenotype 11/11/2015
56 356564 UTSW Slc6a9 1.000 R4744 G1 225 Y 4 117867895 Q562L A T missense Het probably benign 0.003 0.090 phenotype 11/11/2015
57 356607 UTSW Snx29 0.000 R4744 G1 148 Y 16 11349909 Q25* C T nonsense Het probably null 0.976 11/11/2015
58 356549 UTSW St6galnac6 0.102 R4744 G1 225 Y 2 32618543 I231V A G missense Het probably damaging 0.999 0.172 phenotype 11/11/2015
59 356555 UTSW Stard9 0.193 R4744 G1 225 Y 2 120696123 T954A A G missense Het probably benign 0.013 0.090 11/11/2015
60 356617 UTSW Sufu 1.000 R4744 G1 225 Y 19 46483630 M443V A G missense Het possibly damaging 0.779 0.418 phenotype 11/11/2015
61 356580 UTSW Sv2b 0.000 R4744 G1 225 Y 7 75206518 D8G T C missense Het probably benign 0.012 0.067 phenotype 11/11/2015
62 356574 UTSW Tapbpl 0.052 R4744 G1 225 Y 6 125228285 R233W G A missense Het probably damaging 1.000 0.647 phenotype 11/11/2015
63 356561 UTSW Tex10 0.950 R4744 G1 225 Y 4 48469990 L25S A G missense Het probably benign 0.001 0.059 phenotype 11/11/2015
64 356556 UTSW Trp53bp1 0.000 R4744 G1 225 Y 2 121211313 V1254D A T missense Het probably damaging 1.000 0.647 phenotype 11/11/2015
65 356604 UTSW Ugt3a1 0.082 R4744 G1 99 Y 15 9310553 I307N T A missense Het probably benign 0.364 0.090 11/11/2015
66 356586 UTSW Unc13c 0.000 R4744 G1 225 Y 9 73931844 D575G T C missense Het probably damaging 1.000 0.068 phenotype 11/11/2015
67 356579 UTSW Usf2 0.790 R4744 G1 225 Y 7 30954772 D166E A T missense Het probably damaging 1.000 0.080 phenotype 11/11/2015
68 356610 UTSW Usp25 0.000 R4744 G1 225 Y 16 77114989 L969M T A missense Het probably damaging 1.000 0.647 phenotype 11/11/2015
69 356596 UTSW Usp32 1.000 R4744 G1 225 Y 11 84994393 P1276L G A missense Het probably damaging 1.000 0.674 11/11/2015
70 356568 UTSW Vmn2r8 0.081 R4744 G1 225 Y 5 108808581 E58D T A missense Het probably benign 0.002 0.090 11/11/2015
71 356562 UTSW Zfp462 0.430 R4744 G1 225 Y 4 55011598 C40F G T missense Het probably damaging 0.999 0.839 phenotype 11/11/2015
[records 1 to 71 of 71]