Incidental Mutations

84 incidental mutations are currently displayed, and affect 84 genes.
12 are Possibly Damaging.
34 are Probably Damaging.
29 are Probably Benign.
6 are Probably Null.
1 create premature stop codons.
3 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 84 of 84] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 357465 UTSW 1110008P14Rik 0.178 R4750 G1 225 Y 2 32379413 C T unclassified 3875 bp Het probably null 0.677 11/11/2015
2 357489 UTSW 1700074P13Rik 0.057 R4750 G1 225 Y 6 40921021 W243R A G missense Het probably damaging 1.000 0.647 11/11/2015
3 357481 UTSW 2510039O18Rik 0.283 R4750 G1 134 Y 4 147941488 L155Q T A missense Het probably damaging 0.994 0.197 11/11/2015
4 357471 UTSW Aadac 0.000 R4750 G1 225 Y 3 60035817 F48L T C missense Het probably benign 0.000 0.090 phenotype 11/11/2015
5 357503 UTSW Aadat 0.000 R4750 G1 225 Y 8 60526600 N165K T A missense Het probably benign 0.102 0.128 phenotype 11/11/2015
6 357495 UTSW Acan 1.000 R4750 G1 225 Y 7 79092718 D557E C A missense Het probably damaging 0.999 0.192 phenotype 11/11/2015
7 357460 UTSW Adamts4 0.000 R4750 G1 225 Y 1 171251066 V85D T A missense Het probably benign 0.000 0.090 phenotype 11/11/2015
8 357506 UTSW Agt 0.120 R4750 G1 225 Y 8 124556937 V481A A G missense Het probably benign 0.000 0.090 phenotype 11/11/2015
9 357526 UTSW Angpt1 1.000 R4750 G1 225 Y 15 42676401 N21D T C missense Het probably benign 0.003 0.070 phenotype 11/11/2015
10 401877 UTSW Ankrd52 0.958 R4750 G1 225 Y 10 128378089 D38A A C missense Het probably damaging 1.000 0.509 07/15/2016
11 401878 UTSW Ap1g2 0.429 R4750 G1 225 Y 14 55104365 Q247K G T missense Het probably damaging 1.000 0.645 phenotype 07/15/2016
12 357511 UTSW Apaf1 1.000 R4750 G1 225 Y 10 91060188 R341G T C missense Het probably damaging 1.000 0.205 phenotype 11/11/2015
13 357520 UTSW Arf2 0.124 R4750 G1 225 Y 11 103979759 T C critical splice donor site 2 bp Het probably null 0.976 11/11/2015
14 401874 UTSW Arhgef1 0.334 R4750 G1 68 Y 7 24918576 A G intron Het probably benign 0.090 phenotype 07/15/2016
15 357468 UTSW Bbox1 0.069 R4750 G1 225 Y 2 110265521 Y366F T A missense Het possibly damaging 0.934 0.457 phenotype 11/11/2015
16 357484 UTSW Bmp3 0.000 R4750 G1 225 Y 5 98872558 E280G A G missense Het possibly damaging 0.892 0.089 phenotype 11/11/2015
17 401875 UTSW Cd109 0.000 R4750 G1 217 Y 9 78712500 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT critical splice acceptor site Het probably benign 0.090 phenotype 07/15/2016
18 357525 UTSW Cdh12 0.198 R4750 G1 225 Y 15 21583808 V578D T A missense Het possibly damaging 0.593 0.097 phenotype 11/11/2015
19 357508 UTSW Cdk19 0.000 R4750 G1 225 Y 10 40476199 S282P T C missense Het probably damaging 1.000 0.909 phenotype 11/11/2015
20 357500 UTSW Cfap46 0.000 R4750 G1 225 Y 7 139679323 A G critical splice donor site 2 bp Het probably null 0.947 11/11/2015
21 357458 UTSW Cfhr3 0.098 R4750 G1 225 Y 1 139584828 T A exon Het noncoding transcript 0.087 11/11/2015
22 357480 UTSW Ctrc 0.110 R4750 G1 149 Y 4 141841523 Y123F T A missense Het probably benign 0.385 0.205 phenotype 11/11/2015
23 357529 UTSW Enpp4 0.390 R4750 G1 225 Y 17 44102355 M96T A G missense Het probably damaging 1.000 0.891 11/11/2015
24 357482 UTSW Exosc10 0.969 R4750 G1 225 Y 4 148562394 S154T T A missense Het possibly damaging 0.685 0.189 phenotype 11/11/2015
25 357485 UTSW Fbxo21 0.245 R4750 G1 225 Y 5 118000468 R486H G A missense Het probably benign 0.105 0.068 phenotype 11/11/2015
26 357479 UTSW Foxj3 0.386 R4750 G1 225 Y 4 119616590 A204E C A missense Het probably damaging 0.991 0.206 phenotype 11/11/2015
27 357502 UTSW Gas6 0.000 R4750 G1 178 Y 8 13476227 D237A T G missense Het probably benign 0.290 0.384 phenotype 11/11/2015
28 357490 UTSW Gimap8 0.000 R4750 G1 225 Y 6 48650427 S112G A G missense Het probably benign 0.009 0.090 phenotype 11/11/2015
29 357522 UTSW Gm4787 0.069 R4750 G1 225 Y 12 81378367 N339S T C missense Het possibly damaging 0.947 0.179 11/11/2015
30 357459 UTSW Gm6185 0.168 R4750 G1 225 Y 1 161182363 T C exon Het noncoding transcript 0.289 11/11/2015
31 357533 UTSW Gramd3 0.000 R4750 G1 224 Y 18 56432300 E9G A G missense Het probably benign 0.444 0.094 11/11/2015
32 357534 UTSW Hmgxb3 0.685 R4750 G1 225 Y 18 61167496 D169E A T missense Het probably benign 0.000 0.090 phenotype 11/11/2015
33 357507 UTSW Isl2 1.000 R4750 G1 225 Y 9 55544312 V162D T A missense Het probably benign 0.213 0.090 phenotype 11/11/2015
34 357521 UTSW Kcns3 0.115 R4750 G1 225 Y 12 11091654 D348V T A missense Het probably damaging 0.997 0.671 phenotype 11/11/2015
35 357488 UTSW Kcp 0.217 R4750 G1 225 Y 6 29484626 P1318S G A missense Het probably benign 0.027 0.060 phenotype 11/11/2015
36 357477 UTSW Kif12 0.339 R4750 G1 225 Y 4 63167783 Q415L T A missense Het probably damaging 0.993 0.128 phenotype 11/11/2015
37 357531 UTSW Lama3 1.000 R4750 G1 225 Y 18 12504359 H45Q T A missense Het probably benign 0.251 0.090 phenotype 11/11/2015
38 357505 UTSW Lonp2 0.205 R4750 G1 225 Y 8 86631502 K117M A T missense Het probably benign 0.095 0.060 phenotype 11/11/2015
39 357536 UTSW Loxl4 0.000 R4750 G1 158 Y 19 42605004 N243Y T A missense Het probably damaging 0.999 0.114 phenotype 11/11/2015
40 357475 UTSW Lrif1 0.068 R4750 G1 225 Y 3 106735564 Q662K C A missense Het probably benign 0.329 0.073 11/11/2015
41 357519 UTSW Lrrc37a 0.189 R4750 G1 225 Y 11 103455480 I3187L T A missense Het probably benign 0.243 0.090 11/11/2015
42 357527 UTSW Lsg1 0.941 R4750 G1 116 Y 16 30565449 I521T A G missense Het probably damaging 0.987 0.481 phenotype 11/11/2015
43 357470 UTSW Mecom 1.000 R4750 G1 225 Y 3 29957530 K865Q T G missense Het probably damaging 0.974 0.060 phenotype 11/11/2015
44 357514 UTSW Myh10 1.000 R4750 G1 225 Y 11 68785314 I790T T C missense Het probably damaging 1.000 0.603 phenotype 11/11/2015
45 357457 UTSW Nek7 0.000 R4750 G1 207 Y 1 138498673 S234N C T missense Het probably damaging 1.000 0.106 phenotype 11/11/2015
46 357528 UTSW Nepro 1.000 R4750 G1 225 Y 16 44730182 L179P T C missense Het probably damaging 1.000 0.784 phenotype 11/11/2015
47 357476 UTSW Nexn 0.448 R4750 G1 225 Y 3 152237722 C649R A G missense Het probably damaging 1.000 0.952 phenotype 11/11/2015
48 357463 UTSW Nsmf 0.000 R4750 G1 225 Y 2 25055026 S34P T C missense Het probably damaging 0.997 0.102 phenotype 11/11/2015
49 357467 UTSW Olfr1140 0.256 R4750 G1 225 Y 2 87746508 T104I C T missense Het probably benign 0.000 0.090 phenotype 11/11/2015
50 357478 UTSW Olfr1339 0.070 R4750 G1 225 Y 4 118734733 V68D T A missense Het possibly damaging 0.658 0.179 phenotype 11/11/2015
51 357493 UTSW Olfr1350 0.064 R4750 G1 225 Y 7 6570851 I287V A G missense Het probably benign 0.338 0.090 phenotype 11/11/2015
52 357523 UTSW Olfr1364 0.110 R4750 G1 225 Y 13 21573743 S238P A G missense Het possibly damaging 0.478 0.179 phenotype 11/11/2015
53 357466 UTSW Olfr354 0.133 R4750 G1 225 Y 2 36907716 S257T T A missense Het probably benign 0.132 0.157 phenotype 11/11/2015
54 357516 UTSW Olfr406 0.057 R4750 G1 225 Y 11 74269420 F10L T A missense Het probably benign 0.002 0.090 phenotype 11/11/2015
55 357461 UTSW Olfr417 0.070 R4750 G1 225 Y 1 174368922 I2V A G missense Het probably benign 0.018 0.111 phenotype 11/11/2015
56 357497 UTSW Olfr685 0.159 R4750 G1 206 Y 7 105180926 I144N A T missense Het probably damaging 1.000 0.647 phenotype 11/11/2015
57 357498 UTSW Olfr702 0.060 R4750 G1 225 Y 7 106824307 F73S A G missense Het probably damaging 0.984 0.224 phenotype 11/11/2015
58 357515 UTSW P2rx5 0.085 R4750 G1 225 Y 11 73164877 K53N G T missense Het probably damaging 1.000 0.736 phenotype 11/11/2015
59 357532 UTSW Pcdhb20 0.080 R4750 G1 225 Y 18 37506131 A570E C A missense Het possibly damaging 0.481 0.649 phenotype 11/11/2015
60 357512 UTSW Pip4k2c 0.000 R4750 G1 225 Y 10 127211417 H32R T C missense Het unknown 0.073 phenotype 11/11/2015
61 357454 UTSW Pkhd1 0.133 R4750 G1 225 Y 1 20524112 D1259V T A missense Het possibly damaging 0.573 0.179 phenotype 11/11/2015
62 357499 UTSW Plekha7 0.390 R4750 G1 225 Y 7 116137311 V889E A T missense Het probably damaging 1.000 0.141 phenotype 11/11/2015
63 357483 UTSW Polr2b 0.968 R4750 G1 225 Y 5 77332039 E546D A C missense Het possibly damaging 0.924 0.088 phenotype 11/11/2015
64 357472 UTSW Ppm1l 0.190 R4750 G1 225 Y 3 69549328 T193A A G missense Het probably damaging 0.989 0.817 phenotype 11/11/2015
65 357494 UTSW Ppp1r37 0.188 R4750 G1 225 Y 7 19531520 D710E G T missense Het probably benign 0.000 0.090 11/11/2015
66 357510 UTSW Prdm4 0.000 R4750 G1 225 Y 10 85899221 F679L A G missense Het probably damaging 1.000 0.907 phenotype 11/11/2015
67 357524 UTSW Prkcd 0.447 R4750 G1 225 Y 14 30610301 M1T A G start codon destroyed Het probably null 0.988 0.970 phenotype 11/11/2015
68 357462 UTSW Rcor3 0.593 R4750 G1 225 Y 1 192130449 Y77H A G missense Het probably damaging 0.999 0.274 11/11/2015
69 357513 UTSW Rdh5 0.330 R4750 G1 225 Y 10 128918366 E66G T C missense Het possibly damaging 0.916 0.406 phenotype 11/11/2015
70 357469 UTSW Slc12a5 1.000 R4750 G1 225 Y 2 164982931 M396V A G missense Het probably benign 0.065 0.084 phenotype 11/11/2015
71 357453 UTSW Slco5a1 0.073 R4750 G1 225 Y 1 12879280 T629P T G missense Het probably damaging 0.997 0.513 phenotype 11/11/2015
72 357504 UTSW Smarca5 1.000 R4750 G1 225 Y 8 80733707 N133K A C missense Het probably benign 0.000 0.090 phenotype 11/11/2015
73 357517 UTSW Spag5 0.000 R4750 G1 225 N 11 78320052 M927T T C missense Het probably benign 0.001 phenotype 11/11/2015
74 401873 UTSW Spint4 0.060 R4750 G1 225 Y 2 164700146 D39V A T missense Het probably damaging 1.000 0.254 07/15/2016
75 357474 UTSW Syt6 0.156 R4750 G1 225 Y 3 103630917 *512R T A makesense Het probably null 0.858 phenotype 11/11/2015
76 357530 UTSW Tmem247 0.063 R4750 G1 225 Y 17 86922342 C204R T C missense Het probably damaging 0.979 0.476 11/11/2015
77 357491 UTSW Tmem72 0.131 R4750 G1 187 Y 6 116695434 Y149H A G missense Het probably damaging 0.967 0.183 phenotype 11/11/2015
78 357535 UTSW Trpm6 1.000 R4750 G1 225 Y 19 18876064 V1816A T C missense Het probably damaging 0.991 0.266 phenotype 11/11/2015
79 357496 UTSW Usp35 0.103 R4750 G1 225 Y 7 97310339 V1008A A G missense Het possibly damaging 0.845 0.171 11/11/2015
80 357509 UTSW Washc4 0.962 R4750 G1 225 Y 10 83591052 S1075P T C missense Het probably damaging 0.988 0.178 phenotype 11/11/2015
81 357464 UTSW Wdr34 0.185 R4750 G1 225 Y 2 30033920 T198A T C missense Het probably benign 0.004 0.090 phenotype 11/11/2015
82 401876 UTSW Xylb 0.118 R4750 G1 225 Y 9 119359313 G62* G T nonsense Het probably null 0.975 phenotype 07/15/2016
83 357455 UTSW Zfp142 0.000 R4750 G1 225 Y 1 74572458 E623G T C missense Het probably damaging 1.000 0.191 phenotype 11/11/2015
84 357492 UTSW Zfp239 0.000 R4750 G1 225 Y 6 117871739 Y146C A G missense Het probably damaging 1.000 0.491 phenotype 11/11/2015
[records 1 to 84 of 84]