Incidental Mutations

95 incidental mutations are currently displayed, and affect 92 genes.
13 are Possibly Damaging.
36 are Probably Damaging.
26 are Probably Benign.
14 are Probably Null.
6 create premature stop codons.
4 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 95 of 95] per page Full List
ID question?
Source question?
Gene question?
E-score question?
Stock # question?
Gen question?
Vld question?
Strain question?
Chr question?
Position question?
Mutation question?
Type question?
Exon Dist question?
Zygosity question?
Predicted Effect question?
PPH Score question?
Meta Score question?
MGI Phenotype question?
Posted question?
1 357825 UTSW 1700080E11Rik 0.124 R4754 G1 179 Y 9 105144393 F151L A T missense Het probably benign 0.009 0.090 11/11/2015
2 357778 UTSW 4932438A13Rik 1.000 R4754 G1 225 Y 3 37022466 Q3663* C T nonsense Het probably null 0.976 phenotype 11/11/2015
3 357769 UTSW A130010J15Rik 0.084 R4754 G1 225 Y 1 193174529 Y63C A G missense Het probably damaging 1.000 0.394 11/11/2015
4 357785 UTSW Abcb4 0.000 R4754 G1 225 Y 5 8910717 F266L C A missense Het probably damaging 0.997 0.478 phenotype 11/11/2015
5 357814 UTSW Adam8 0.000 R4754 G1 225 Y 7 139984780 I681N A T missense Het possibly damaging 0.869 0.179 phenotype 11/11/2015
6 357788 UTSW Adgrf3 0.000 R4754 G1 225 Y 5 30197617 T A critical splice acceptor site Het probably null 0.948 11/11/2015
7 357845 UTSW Ang2 0.075 R4754 G1 225 Y 14 51195517 V136A A G missense Het probably damaging 1.000 0.880 11/11/2015
8 357766 UTSW Ankar 0.073 R4754 G1 225 Y 1 72698694 G110R C T missense Het probably damaging 1.000 0.137 11/11/2015
9 357840 UTSW Ap3b1 0.600 R4754 G1 225 Y 13 94403960 L130P T C missense Het probably damaging 1.000 0.890 phenotype 11/11/2015
10 357829 UTSW Apc2 0.214 R4754 G1 225 Y 10 80314358 W1749G T G missense Het probably benign 0.006 0.090 phenotype 11/11/2015
11 357836 UTSW Asb2 0.083 R4754 G1 225 Y 12 103323837 N565S T C missense Het possibly damaging 0.954 0.171 phenotype 11/11/2015
12 357767 UTSW B3gnt7 0.159 R4754 G1 225 Y 1 86305557 T58K C A missense Het probably benign 0.008 0.130 11/11/2015
13 357804 UTSW Brpf1 0.965 R4754 G1 225 Y 6 113320447 N876K T A missense Het possibly damaging 0.919 0.066 phenotype 11/11/2015
14 357830 UTSW Ccdc157 0.059 R4754 G1 225 Y 11 4148994 I69V T C missense Het possibly damaging 0.455 0.069 11/11/2015
15 404219 UTSW Cd109 0.000 R4754 G1 164 Y 9 78712500 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT critical splice acceptor site Het probably benign 0.090 phenotype 07/22/2016
16 357768 UTSW Cdh20 0.266 R4754 G1 129 Y 1 104984685 I555F A T missense Het probably damaging 0.993 0.651 phenotype 11/11/2015
17 357794 UTSW Cfap73 0.301 R4754 G1 225 Y 5 120629664 D274G T C missense Het probably damaging 1.000 0.679 11/11/2015
18 357783 UTSW Chd5 0.000 R4754 G1 170 Y 4 152377746 I1310N T A missense Het probably damaging 0.993 0.079 phenotype 11/11/2015
19 357816 UTSW Ckap2 0.307 R4754 G1 225 Y 8 22168895 I611F T A missense Het possibly damaging 0.931 0.179 phenotype 11/11/2015
20 357790 UTSW Cpeb2 0.414 R4754 G1 225 Y 5 43285857 I964V A G missense Het possibly damaging 0.930 0.107 phenotype 11/11/2015
21 357813 UTSW Ctbp2 1.000 R4754 G1 225 Y 7 133023558 C A splice site 5 bp Het probably null 0.976 phenotype 11/11/2015
22 404222 UTSW Dhrs2 0.000 R4754 G1 225 Y 14 55238748 I142F A T missense Het probably damaging 0.966 0.647 07/22/2016
23 357848 UTSW Dnah5 0.818 R4754 G1 225 Y 15 28420955 T A splice site Het probably null 0.976 phenotype 11/11/2015
24 357764 UTSW Dst 0.338 R4754 G1 225 Y 1 34212309 S1822P T C missense Het probably damaging 0.999 0.096 phenotype 11/11/2015
25 357777 UTSW Ect2 1.000 R4754 G1 225 Y 3 27126963 K581E T C missense Het probably damaging 0.996 0.311 phenotype 11/11/2015
26 357803 UTSW Edem1 0.229 R4754 G1 225 Y 6 108841697 T222M C T missense Het probably damaging 1.000 0.534 11/11/2015
27 357795 UTSW Eif2ak1 0.149 R4754 G1 225 Y 5 143901803 M592V A G missense Het probably damaging 0.991 0.084 phenotype 11/11/2015
28 357851 UTSW Endou 0.000 R4754 G1 225 Y 15 97726539 D49A T G missense Het probably damaging 0.993 0.647 phenotype 11/11/2015
29 357781 UTSW Ensa 0.103 R4754 G1 225 Y 3 95622554 A G unclassified Het probably benign phenotype 11/11/2015
30 357789 UTSW Evc2 1.000 R4754 G1 225 Y 5 37387031 R708L G T missense Het probably damaging 0.988 0.647 phenotype 11/11/2015
31 357857 UTSW Fam120b 0.000 R4754 G1 225 Y 17 15422962 C668S T A missense Het probably damaging 0.997 0.768 11/11/2015
32 357763 UTSW Fam135a 0.617 R4754 G1 225 Y 1 24028754 C798* A T nonsense Het probably null 0.976 11/11/2015
33 357849 UTSW Fam135b 0.000 R4754 G1 225 Y 15 71462951 D798G T C missense Het probably benign 0.011 0.070 11/11/2015
34 357842 UTSW Fam208a 1.000 R4754 G1 225 Y 14 27461095 I504L A T missense Het probably benign 0.000 0.090 phenotype 11/11/2015
35 357772 UTSW Fshb 0.232 R4754 G1 225 Y 2 107057282 *131E A C makesense Het probably null 0.828 phenotype 11/11/2015
36 357791 UTSW G3bp2 1.000 R4754 G1 225 Y 5 92054909 V441M C T missense Het possibly damaging 0.848 0.116 11/11/2015
37 357852 UTSW Galnt6 0.156 R4754 G1 225 Y 15 100699224 F354I A T missense Het probably damaging 1.000 0.637 phenotype 11/11/2015
38 357823 UTSW Gm1123 0.125 R4754 G1 225 Y 9 99023240 C A splice site 3 bp Het probably null 0.976 11/11/2015
39 357824 UTSW Gm1123 0.125 R4754 G1 225 Y 9 99023241 A T critical splice donor site 2 bp Het probably null 0.949 11/11/2015
40 357773 UTSW Gm15130 0.077 R4754 G1 225 Y 2 111142862 N115S T C missense Het unknown 0.087 11/11/2015
41 357835 UTSW Gm7104 0.294 R4754 G1 221 Y 12 88285995 A G unclassified Het noncoding transcript 0.087 11/11/2015
42 357780 UTSW Gm9762 0.189 R4754 G1 225 Y 3 78966421 A T exon Het noncoding transcript 11/11/2015
43 357801 UTSW Grip2 0.000 R4754 G1 225 Y 6 91779182 V508A A G missense Het probably damaging 0.997 0.254 phenotype 11/11/2015
44 357802 UTSW Grip2 0.000 R4754 G1 225 N 6 91779192 T505A T C missense Het probably damaging 0.974 phenotype 11/11/2015
45 404221 UTSW Haus4 0.154 R4754 G1 225 Y 14 54549892 A G critical splice donor site 2 bp Het probably null 0.959 phenotype 07/22/2016
46 357821 UTSW Herc1 0.000 R4754 G1 225 Y 9 66501206 D4571E T A missense Het probably benign 0.003 0.063 phenotype 11/11/2015
47 357838 UTSW Hnrnpk 0.902 R4754 G1 225 Y 13 58399136 T A unclassified Het probably benign phenotype 11/11/2015
48 357765 UTSW Ica1l 0.000 R4754 G1 225 Y 1 60028162 Y23C T C missense Het probably damaging 1.000 0.822 phenotype 11/11/2015
49 357807 UTSW Kansl2-ps 0.317 R4754 G1 225 Y 7 72673133 A G unclassified Het noncoding transcript 0.059 11/11/2015
50 357841 UTSW Kcnma1 0.836 R4754 G1 225 Y 14 23363836 D833G T C missense Het probably damaging 0.965 0.218 phenotype 11/11/2015
51 357787 UTSW Kmt2e 1.000 R4754 G1 225 Y 5 23482441 I430F A T missense Het possibly damaging 0.878 0.437 phenotype 11/11/2015
52 357828 UTSW Lama2 0.336 R4754 G1 225 Y 10 27118531 R1794L C A missense Het possibly damaging 0.580 0.179 phenotype 11/11/2015
53 357846 UTSW Mcpt1 0.132 R4754 G1 225 Y 14 56018680 F59I T A missense Het probably damaging 1.000 0.545 phenotype 11/11/2015
54 357784 UTSW Mib2 0.000 R4754 G1 195 Y 4 155655365 T783K G T missense Het possibly damaging 0.904 0.094 phenotype 11/11/2015
55 357826 UTSW Nlrp4g 0.063 R4754 G1 225 Y 9 124349788 T C unclassified Het noncoding transcript 0.832 11/11/2015
56 357831 UTSW Obscn 0.768 R4754 G1 225 N 11 59036043 I6352V T C missense Het possibly damaging 0.807 phenotype 11/11/2015
57 357771 UTSW Olfr1245 0.178 R4754 G1 225 Y 2 89575047 H226Q A T missense Het probably benign 0.000 0.090 phenotype 11/11/2015
58 404223 UTSW Olfr1456-ps1 0.126 R4754 G1 225 Y 19 13078861 T A exon Het noncoding transcript 0.087 07/22/2016
59 357815 UTSW Olfr531 0.059 R4754 G1 225 Y 7 140400159 A296T C T missense Het probably damaging 0.987 0.244 phenotype 11/11/2015
60 357809 UTSW Olfr68 0.055 R4754 G1 225 Y 7 103777668 I226V T C missense Het probably benign 0.001 0.110 phenotype 11/11/2015
61 357843 UTSW Olfr728 0.269 R4754 G1 225 Y 14 50140033 N202I T A missense Het possibly damaging 0.898 0.566 phenotype 11/11/2015
62 357844 UTSW Olfr728 0.269 R4754 G1 225 Y 14 50140034 N202H T G missense Het probably benign 0.020 0.313 phenotype 11/11/2015
63 357779 UTSW Pcdh10 0.375 R4754 G1 225 Y 3 45380637 R462H G A missense Het probably damaging 0.988 0.218 phenotype 11/11/2015
64 357862 UTSW Pcdhga12 0.162 R4754 G1 225 Y 18 37766551 N145K C A missense Het probably damaging 0.998 0.647 phenotype 11/11/2015
65 357833 UTSW Pik3r6 0.054 R4754 G1 209 Y 11 68544775 L613Q T A missense Het probably damaging 0.999 0.122 phenotype 11/11/2015
66 357819 UTSW Pknox2 0.255 R4754 G1 225 Y 9 36909720 D282G T C missense Het probably damaging 0.984 0.069 phenotype 11/11/2015
67 357822 UTSW Plod2 1.000 R4754 G1 225 Y 9 92606531 Y624* T G nonsense Het probably null 0.975 phenotype 11/11/2015
68 357861 UTSW Prkd3 0.197 R4754 G1 225 Y 17 78956614 V684F C A missense Het probably damaging 1.000 0.132 phenotype 11/11/2015
69 357776 UTSW Ptpn1 0.921 R4754 G1 225 Y 2 167974160 V198D T A missense Het probably damaging 1.000 0.968 phenotype 11/11/2015
70 357786 UTSW Ptpn12 1.000 R4754 G1 225 Y 5 20998589 P397Q G T missense Het probably benign 0.342 0.090 phenotype 11/11/2015
71 357847 UTSW Rad1 0.944 R4754 G1 225 Y 15 10493126 C A intron Het probably benign 0.090 phenotype 11/11/2015
72 357796 UTSW Rasl11a 0.200 R4754 G1 225 Y 5 146847015 D90G A G missense Het probably benign 0.026 0.143 phenotype 11/11/2015
73 357800 UTSW Rnf181 0.114 R4754 G1 185 Y 6 72360560 A G unclassified Het probably benign 0.090 phenotype 11/11/2015
74 357774 UTSW Ryr3 0.573 R4754 G1 225 Y 2 112757639 I2652M T C missense Het possibly damaging 0.940 0.067 phenotype 11/11/2015
75 357806 UTSW Siglecg 0.098 R4754 G1 225 Y 7 43411871 C T intron Het probably benign phenotype 11/11/2015
76 357856 UTSW Slc22a3 0.000 R4754 G1 112 Y 17 12507195 S44G T C missense Het probably benign 0.025 0.090 phenotype 11/11/2015
77 357850 UTSW Slc38a1 0.181 R4754 G1 225 Y 15 96576782 F463I A T missense Het probably damaging 0.983 0.161 phenotype 11/11/2015
78 357810 UTSW Smg1 1.000 R4754 G1 225 Y 7 118156731 A T utr 3 prime Het probably benign 0.443 phenotype 11/11/2015
79 357837 UTSW Syk 1.000 R4754 G1 225 Y 13 52612259 T C intron Het probably benign phenotype 11/11/2015
80 357860 UTSW Tbc1d5 0.000 R4754 G1 225 Y 17 50800165 I454M T C missense Het probably benign 0.031 0.064 11/11/2015
81 357818 UTSW Tmed6 0.000 R4754 G1 225 Y 8 107063730 D146Y C A missense Het probably damaging 0.988 0.272 11/11/2015
82 357834 UTSW Tmem132e 0.288 R4754 G1 225 Y 11 82444851 K828* A T nonsense Het probably null 0.975 11/11/2015
83 357853 UTSW Tmprss15 0.000 R4754 G1 225 Y 16 79054124 S294T A T missense Het probably damaging 0.980 0.177 phenotype 11/11/2015
84 357775 UTSW Trp53bp1 0.000 R4754 G1 225 Y 2 121207879 S1493P A G missense Het probably damaging 0.999 0.705 phenotype 11/11/2015
85 357782 UTSW Tshb 0.176 R4754 G1 225 Y 3 102778175 I46N A T missense Het probably damaging 0.997 0.795 phenotype 11/11/2015
86 357805 UTSW Tspan11 0.071 R4754 G1 225 Y 6 127938220 V99A T C missense Het probably benign 0.000 0.090 11/11/2015
87 357770 UTSW Ttn 1.000 R4754 G1 225 Y 2 76715561 T24176A T C missense Het probably benign 0.054 0.090 phenotype 11/11/2015
88 357799 UTSW Vmn1r8 0.059 R4754 G1 225 Y 6 57035967 M1T T C start codon destroyed Het probably null 0.999 0.976 11/11/2015
89 357858 UTSW Vmn2r104 0.098 R4754 G1 225 Y 17 20040768 Y464* A T nonsense Het probably null 0.976 11/11/2015
90 357859 UTSW Vmn2r110 0.263 R4754 G1 225 Y 17 20596196 T22A T C missense Het probably benign 0.001 0.090 11/11/2015
91 357792 UTSW Vmn2r17 0.083 R4754 G1 225 Y 5 109452849 I671K T A missense Het probably damaging 0.986 0.647 11/11/2015
92 357854 UTSW Zbtb21 0.530 R4754 G1 225 Y 16 97951266 N606D T C missense Het probably damaging 1.000 0.249 11/11/2015
93 357864 UTSW Zfy2 0.058 R4754 G1 222 Y Y 2121477 S139T A T missense Het probably benign 0.016 0.090 11/11/2015
94 357832 UTSW Zkscan17 1.000 R4754 G1 225 Y 11 59503025 R156* G A nonsense Het probably null 0.976 11/11/2015
95 357811 UTSW Zp2 0.059 R4754 G1 225 Y 7 120138318 V248A A G missense Het probably benign 0.006 0.090 phenotype 11/11/2015
[records 1 to 95 of 95]