Incidental Mutations

114 incidental mutations are currently displayed, and affect 111 genes.
10 are Possibly Damaging.
42 are Probably Damaging.
45 are Probably Benign.
13 are Probably Null.
10 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 114] next >> last >| per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 357881 UTSW 4930449A18Rik 0.168 R4755 G1 225 Y 3 59825859 T A exon Het noncoding transcript 11/11/2015
2 357876 UTSW Accs 0.122 R4755 G1 225 Y 2 93841337 E236G T C missense Het probably damaging 0.999 0.674 11/11/2015
3 357890 UTSW Agrn 0.556 R4755 G1 225 Y 4 156173522 C T intron Het probably benign phenotype 11/11/2015
4 357931 UTSW Ahi1 0.847 R4755 G1 225 Y 10 21055047 I929V A G missense Het possibly damaging 0.941 0.133 phenotype 11/11/2015
5 357948 UTSW Akap5 0.311 R4755 G1 225 Y 12 76327807 C4* C A nonsense Het probably null 0.976 phenotype 11/11/2015
6 357929 UTSW Amotl2 0.190 R4755 G1 208 Y 9 102720480 H146L A T missense Het probably damaging 0.999 0.193 phenotype 11/11/2015
7 357922 UTSW Ank1 0.528 R4755 G1 225 Y 8 23104974 N666S A G missense Het probably damaging 0.996 0.127 phenotype 11/11/2015
8 470345 UTSW Atp10d 0.434 R4755 G1 225 N 5 72246166 T373S A T missense Het probably benign 0.036 03/08/2017
9 357878 UTSW Bpifb9b 0.156 R4755 G1 225 Y 2 154319694 M582K T A missense Het probably benign 0.008 0.090 11/11/2015
10 357901 UTSW Brca2 1.000 R4755 G1 225 Y 5 150559987 T A intron Het probably null 0.976 phenotype 11/11/2015
11 357882 UTSW C130079G13Rik 0.079 R4755 G1 225 Y 3 59936314 A143V C T missense Het probably benign 0.000 0.090 11/11/2015
12 357921 UTSW C330021F23Rik R4755 G1 223 N 8 3583922 S8C A T missense Het probably damaging 0.998 11/11/2015
13 357893 UTSW Ccdc149 0.093 R4755 G1 225 Y 5 52404151 V229A A G missense Het probably damaging 0.961 0.097 11/11/2015
14 404195 UTSW Cd109 0.000 R4755 G1 205 Y 9 78712500 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT critical splice acceptor site Het probably benign 0.090 phenotype 07/22/2016
15 357886 UTSW Cdk5rap2 0.388 R4755 G1 225 Y 4 70238425 S1617P A G missense Het probably damaging 0.999 0.098 phenotype 11/11/2015
16 357957 UTSW Cenpk 0.829 R4755 G1 225 Y 13 104230871 M37L A T missense Het probably benign 0.019 0.079 phenotype 11/11/2015
17 357958 UTSW Cenpk 0.829 R4755 G1 225 Y 13 104249512 H305L A T missense Het probably benign 0.057 0.356 phenotype 11/11/2015
18 357924 UTSW Ces5a 0.134 R4755 G1 225 Y 8 93535677 A11S C A missense Het probably benign 0.394 0.090 phenotype 11/11/2015
19 357865 UTSW Cfap65 0.598 R4755 G1 225 Y 1 74928361 E186G T C missense Het probably damaging 1.000 0.177 phenotype 11/11/2015
20 357868 UTSW Cfh 0.124 R4755 G1 225 Y 1 140088808 I593F T A missense Het probably damaging 1.000 0.760 phenotype 11/11/2015
21 357928 UTSW Clstn2 0.000 R4755 G1 225 Y 9 97445673 V961I C T missense Het probably benign 0.006 0.090 phenotype 11/11/2015
22 357945 UTSW Cog5 0.912 R4755 G1 225 Y 12 31869406 T A splice site Het probably null 0.976 phenotype 11/11/2015
23 357866 UTSW Col4a4 0.103 R4755 G1 225 Y 1 82541174 D100G T C missense Het unknown 0.085 phenotype 11/11/2015
24 357900 UTSW Cyp3a41a 0.190 R4755 G1 225 N 5 145715506 D61G T C missense Het probably damaging 0.999 11/11/2015
25 357898 UTSW Dnah10 0.000 R4755 G1 225 Y 5 124747745 N655S A G missense Het probably benign 0.006 0.081 phenotype 11/11/2015
26 357885 UTSW Dnaic1 0.174 R4755 G1 225 N 4 41610269 T295R C G missense Het probably damaging 0.991 phenotype 11/11/2015
27 404191 UTSW Dnajc6 0.128 R4755 G1 59 Y 4 101550799 A44V C T missense Het probably damaging 0.997 0.084 phenotype 07/22/2016
28 357937 UTSW Eif4enif1 0.409 R4755 G1 225 Y 11 3244016 D960V A T missense Het probably damaging 1.000 0.689 phenotype 11/11/2015
29 357889 UTSW Fam167b 0.152 R4755 G1 225 Y 4 129578342 G12R C T missense Het probably damaging 0.982 0.647 11/11/2015
30 357869 UTSW Fam20b 1.000 R4755 G1 225 Y 1 156687496 Y266* A T nonsense Het probably null 0.976 phenotype 11/11/2015
31 357964 UTSW Fer1l6 0.096 R4755 G1 225 Y 15 58640211 V1509D T A missense Het probably benign 0.093 0.271 11/11/2015
32 404192 UTSW Fhad1 0.068 R4755 G1 225 Y 4 141928483 I105N A T missense Het probably damaging 0.998 0.092 07/22/2016
33 357870 UTSW Fmo2 0.058 R4755 G1 225 Y 1 162888805 D71G T C missense Het probably damaging 0.999 0.661 phenotype 11/11/2015
34 357918 UTSW Folr2 0.000 R4755 G1 225 Y 7 101843799 T6A T C missense Het possibly damaging 0.858 0.179 phenotype 11/11/2015
35 404193 UTSW Fry 0.719 R4755 G1 225 Y 5 150398254 E1018A A C missense Het probably damaging 0.992 0.084 07/22/2016
36 357939 UTSW Gas2l2 0.000 R4755 G1 225 Y 11 83429367 I21T A G missense Het probably damaging 0.993 0.123 phenotype 11/11/2015
37 357974 UTSW Gfra1 1.000 R4755 G1 225 Y 19 58453244 Y85C T C missense Het probably damaging 1.000 0.240 phenotype 11/11/2015
38 404190 UTSW Gm9117 0.645 R4755 G1 105 Y 3 93938786 T C unclassified Het probably null 0.976 07/22/2016
39 357954 UTSW Gpld1 0.000 R4755 G1 225 Y 13 24979688 Y43F A T missense Het probably benign 0.131 0.084 phenotype 11/11/2015
40 357955 UTSW Gpld1 0.000 R4755 G1 225 Y 13 24979692 Y44* T A nonsense Het probably null 0.976 phenotype 11/11/2015
41 357905 UTSW Grid2 0.000 R4755 G1 225 Y 6 63908988 T123A A G missense Het probably benign 0.043 0.089 phenotype 11/11/2015
42 357965 UTSW Grina 0.238 R4755 G1 225 Y 15 76249242 L305P T C missense Het probably damaging 0.999 0.805 phenotype 11/11/2015
43 357883 UTSW Gucy1a1 0.194 R4755 G1 225 Y 3 82094795 A659V G A missense Het probably benign 0.398 0.103 phenotype 11/11/2015
44 357969 UTSW H2-T10 0.067 R4755 G1 225 Y 17 36118945 K319* T A nonsense Het probably null 0.965 11/11/2015
45 357932 UTSW Hey2 0.873 R4755 G1 225 Y 10 30834304 V151E A T missense Het probably benign 0.002 0.208 phenotype 11/11/2015
46 357951 UTSW Ighv1-69 0.870 R4755 G1 225 Y 12 115623558 T13I G A missense Het probably benign 0.007 0.090 11/11/2015
47 357967 UTSW Il1rap 0.000 R4755 G1 225 Y 16 26722782 A591E C A missense Het probably benign 0.202 0.090 phenotype 11/11/2015
48 357968 UTSW Ildr1 0.000 R4755 G1 225 Y 16 36722021 L261P T C missense Het probably benign 0.001 0.143 phenotype 11/11/2015
49 357887 UTSW Jak1 1.000 R4755 G1 225 Y 4 101174157 Y463H A G missense Het probably damaging 1.000 0.412 phenotype 11/11/2015
50 357872 UTSW Lrp1b 0.000 R4755 G1 225 Y 2 41269273 I1666V T C missense Het probably benign 0.068 0.063 phenotype 11/11/2015
51 357873 UTSW Lrp1b 0.000 R4755 G1 225 Y 2 41471016 T592S T A missense Het probably benign 0.000 0.139 phenotype 11/11/2015
52 357925 UTSW Lrrc36 0.165 R4755 G1 225 Y 8 105452144 T445A A G missense Het possibly damaging 0.831 0.076 11/11/2015
53 357871 UTSW Ly9 0.000 R4755 G1 225 Y 1 171607238 S29F G A missense Het probably damaging 0.986 0.486 phenotype 11/11/2015
54 357938 UTSW Mapk7 1.000 R4755 G1 225 Y 11 61490843 C32W A C missense Het probably damaging 0.999 0.087 phenotype 11/11/2015
55 357944 UTSW March10 0.062 R4755 G1 123 Y 11 105364476 C T intron Het probably benign phenotype 11/11/2015
56 357934 UTSW Mier2 0.277 R4755 G1 225 Y 10 79549197 M119K A T missense Het probably damaging 0.999 0.148 11/11/2015
57 357892 UTSW Mpv17 0.000 R4755 G1 225 Y 5 31145982 C59* A T nonsense Het probably null 0.975 phenotype 11/11/2015
58 357942 UTSW Mrpl27 0.944 R4755 G1 143 Y 11 94653833 G A start gained Het probably benign 0.108 phenotype 11/11/2015
59 357897 UTSW Myo18b 1.000 R4755 G1 225 Y 5 112874474 Q351* G A nonsense Het probably null 0.976 phenotype 11/11/2015
60 357936 UTSW Myo1a 0.129 R4755 G1 225 Y 10 127715688 I704M A G missense Het probably damaging 1.000 0.357 phenotype 11/11/2015
61 357920 UTSW Nadsyn1 0.000 R4755 G1 225 Y 7 143806913 C373R A G missense Het probably damaging 1.000 0.975 phenotype 11/11/2015
62 357930 UTSW Nckipsd 0.428 R4755 G1 225 Y 9 108814739 A513E C A missense Het probably benign 0.280 0.083 phenotype 11/11/2015
63 357874 UTSW Neb 0.775 R4755 G1 225 Y 2 52220209 D209G T C missense Het probably damaging 0.997 0.290 phenotype 11/11/2015
64 357953 UTSW Nkapl 0.263 R4755 G1 225 Y 13 21468287 Q52L T A missense Het unknown 0.087 phenotype 11/11/2015
65 357899 UTSW Nptx2 0.000 R4755 G1 150 Y 5 144546440 S126N G A missense Het probably benign 0.011 0.059 phenotype 11/11/2015
66 357903 UTSW Olfr13 0.269 R4755 G1 225 Y 6 43174043 S19N G A missense Het probably benign 0.002 0.090 phenotype 11/11/2015
67 357919 UTSW Olfr653 0.086 R4755 G1 225 Y 7 104580061 Y138* T A nonsense Het probably null 0.976 phenotype 11/11/2015
68 357926 UTSW Olfr829 0.188 R4755 G1 225 Y 9 18857180 H185L A T missense Het probably benign 0.026 0.090 phenotype 11/11/2015
69 357927 UTSW Olfr917 0.068 R4755 G1 225 Y 9 38665832 V4A A G missense Het probably benign 0.000 0.090 phenotype 11/11/2015
70 357891 UTSW Pclo 0.000 R4755 G1 225 Y 5 14714348 R4278S A T missense Het unknown 0.259 phenotype 11/11/2015
71 357949 UTSW Pcnx 0.000 R4755 G1 225 Y 12 81950294 L988R T G missense Het probably damaging 1.000 0.462 phenotype 11/11/2015
72 357952 UTSW Prl2c5 0.130 R4755 G1 225 N 13 13189385 N75K C A missense Het probably benign 0.000 11/11/2015
73 357971 UTSW Prpf19 1.000 R4755 G1 225 Y 19 10897790 T G intron Het probably benign 0.090 phenotype 11/11/2015
74 357947 UTSW Ralgapa1 0.833 R4755 G1 225 Y 12 55712748 S997P A G missense Het probably damaging 1.000 0.079 phenotype 11/11/2015
75 357966 UTSW Rangap1 1.000 R4755 G1 225 Y 15 81712917 T226A T C missense Het probably benign 0.004 0.123 phenotype 11/11/2015
76 357910 UTSW Rimklb 0.000 R4755 G1 225 Y 6 122456406 L262F G A missense Het probably damaging 1.000 0.415 11/11/2015
77 357917 UTSW Rnf169 0.215 R4755 G1 225 Y 7 99925723 M555T A G missense Het probably benign 0.011 0.062 11/11/2015
78 357962 UTSW Rp1l1 0.072 R4755 G1 225 Y 14 64030070 D1035V A T missense Het probably benign 0.342 0.090 phenotype 11/11/2015
79 357973 UTSW Scd2 1.000 R4755 G1 225 Y 19 44301352 L262Q T A missense Het probably damaging 1.000 0.647 phenotype 11/11/2015
80 357914 UTSW Scgb2b12 0.038 R4755 G1 225 Y 7 32325531 M84L T A missense Het probably benign 0.025 0.090 11/11/2015
81 357894 UTSW Shroom3 1.000 R4755 G1 208 Y 5 92943086 V1151F G T missense Het probably damaging 0.997 0.647 phenotype 11/11/2015
82 357950 UTSW Sipa1l1 0.000 R4755 G1 225 Y 12 82372386 V613I G A missense Het possibly damaging 0.737 0.092 11/11/2015
83 357970 UTSW Slc25a23 0.000 R4755 G1 225 Y 17 57052794 D67V T A missense Het possibly damaging 0.920 0.795 phenotype 11/11/2015
84 357943 UTSW Slc25a39 0.881 R4755 G1 225 N 11 102406666 C T start gained Het probably benign phenotype 11/11/2015
85 357875 UTSW Slc4a10 0.000 R4755 G1 225 Y 2 62296988 F895Y T A missense Het probably damaging 0.999 0.857 phenotype 11/11/2015
86 357933 UTSW Slc5a4a 0.081 R4755 G1 225 Y 10 76186564 K578Q A C missense Het probably benign 0.005 0.107 11/11/2015
87 357909 UTSW Slc6a13 0.274 R4755 G1 225 Y 6 121325049 G197S G A missense Het probably damaging 1.000 0.647 phenotype 11/11/2015
88 357972 UTSW Smarca2 0.000 R4755 G1 225 Y 19 26654483 E566V A T missense Het possibly damaging 0.861 0.111 phenotype 11/11/2015
89 357963 UTSW Sorbs3 0.000 R4755 G1 225 Y 14 70184099 N594K A T missense Het probably benign 0.001 0.090 phenotype 11/11/2015
90 404196 UTSW Spata22 0.000 R4755 G1 225 Y 11 73345756 D296V A T missense Het probably damaging 1.000 0.375 phenotype 07/22/2016
91 357916 UTSW Sphk2 0.000 R4755 G1 225 Y 7 45713634 A11V G A missense Het possibly damaging 0.647 0.073 phenotype 11/11/2015
92 357895 UTSW Spp1 0.000 R4755 G1 225 N 5 104435215 A T intron Het probably benign phenotype 11/11/2015
93 357946 UTSW Strn3 1.000 R4755 G1 225 Y 12 51610216 I760L T A missense Het possibly damaging 0.698 0.080 11/11/2015
94 357956 UTSW Syk 1.000 R4755 G1 225 Y 13 52641986 Y539F A T missense Het probably benign 0.251 0.191 phenotype 11/11/2015
95 357867 UTSW Thsd7b 0.190 R4755 G1 225 Y 1 130210264 Y1560N T A missense Het probably benign 0.013 0.396 11/11/2015
96 404194 UTSW Tmod2 0.000 R4755 G1 225 Y 9 75597212 E42* C A nonsense Het probably null 0.975 phenotype 07/22/2016
97 357941 UTSW Tom1l1 0.199 R4755 G1 225 Y 11 90685116 E30G T C missense Het probably damaging 1.000 0.267 11/11/2015
98 357959 UTSW Trav10 0.186 R4755 G1 225 Y 14 53506061 A40T G A missense Het probably benign 0.122 0.090 11/11/2015
99 357960 UTSW Trav14-2 0.166 R4755 G1 225 Y 14 53640780 G A unclassified Het probably benign 0.090 11/11/2015
100 357904 UTSW Tril 0.226 R4755 G1 225 Y 6 53818464 E591V T A missense Het probably damaging 0.989 0.110 phenotype 11/11/2015
[records 1 to 100 of 114] next >> last >|