Incidental Mutations

70 incidental mutations are currently displayed, and affect 70 genes.
8 are Possibly Damaging.
27 are Probably Damaging.
30 are Probably Benign.
4 are Probably Null.
2 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 70 of 70] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 368873 UTSW Adam4 0.064 R4794 G1 225 Y 12 81421424 I141K A T missense Het probably damaging 0.993 0.647 02/04/2016
2 368877 UTSW Adgrb1 0.000 R4794 G1 225 Y 15 74588129 E537G A G missense Het probably damaging 1.000 0.251 phenotype 02/04/2016
3 368840 UTSW Asic3 0.102 R4794 G1 225 Y 5 24415897 A259V C T missense Het probably damaging 0.964 0.647 phenotype 02/04/2016
4 368859 UTSW Bcar1 1.000 R4794 G1 225 Y 8 111720920 Q142* G A nonsense Het probably null 0.976 phenotype 02/04/2016
5 368868 UTSW Bcas3 0.745 R4794 G1 225 Y 11 85509468 V200A T C missense Het probably damaging 0.999 0.073 02/04/2016
6 368824 UTSW Cd302 0.263 R4794 G1 225 Y 2 60272149 I42N A T missense Het probably benign 0.063 0.085 phenotype 02/04/2016
7 368885 UTSW Colec12 0.685 R4794 G1 225 Y 18 9848984 N387K C A missense Het probably damaging 0.988 0.647 phenotype 02/04/2016
8 368820 UTSW Copa 0.966 R4794 G1 225 Y 1 172119321 I1032N T A missense Het probably damaging 1.000 0.747 phenotype 02/04/2016
9 368829 UTSW D630003M21Rik 0.072 R4794 G1 225 Y 2 158196139 T1129S G C missense Het probably benign 0.000 0.090 02/04/2016
10 368846 UTSW D630045J12Rik 0.000 R4794 G1 225 Y 6 38194485 T916I G A missense Het possibly damaging 0.899 0.179 phenotype 02/04/2016
11 404198 UTSW Dnajb13 0.245 R4794 G1 225 Y 7 100503992 A241T C T missense Het probably damaging 1.000 phenotype 07/22/2016
12 368853 UTSW Dyrk4 0.000 R4794 G1 225 Y 6 126885337 N397K G T missense Het possibly damaging 0.792 0.179 phenotype 02/04/2016
13 368869 UTSW Eftud2 1.000 R4794 G1 225 Y 11 102870177 Y114F T A missense Het probably benign 0.139 0.068 phenotype 02/04/2016
14 368862 UTSW Epm2a 0.232 R4794 G1 225 Y 10 11390853 D114G A G missense Het probably benign 0.015 0.090 phenotype 02/04/2016
15 404200 UTSW Exoc5 0.916 R4794 G1 225 Y 14 49048900 T C critical splice acceptor site Het probably null 0.950 phenotype 07/22/2016
16 368817 UTSW Fam135a 0.557 R4794 G1 225 Y 1 24029160 T706I G A missense Het probably benign 0.363 0.090 02/04/2016
17 368870 UTSW Fasn 1.000 R4794 G1 225 Y 11 120811295 V1845A A G missense Het probably benign 0.364 0.117 phenotype 02/04/2016
18 368845 UTSW Fscn3 0.187 R4794 G1 225 Y 6 28430596 E255G A G missense Het probably damaging 1.000 0.603 02/04/2016
19 368858 UTSW Galnt7 0.461 R4794 G1 225 Y 8 57545363 Y311N A T missense Het probably damaging 0.996 0.470 phenotype 02/04/2016
20 368825 UTSW Gm13757 0.071 R4794 G1 225 Y 2 88446347 M197K A T missense Het probably benign 0.117 0.090 02/04/2016
21 368854 UTSW Gm5724 0.077 R4794 G1 225 Y 6 141767562 V31A A G missense Het probably benign 0.114 0.115 02/04/2016
22 368875 UTSW Gm8765 0.093 R4794 G1 225 Y 13 50703239 P971R C G missense Het probably benign 0.069 0.090 02/04/2016
23 368876 UTSW Grid1 0.100 R4794 G1 225 Y 14 34822622 L50P T C missense Het probably damaging 0.994 0.134 phenotype 02/04/2016
24 368844 UTSW Hepacam2 0.177 R4794 G1 225 Y 6 3475933 F331L A G missense Het probably damaging 0.960 0.250 phenotype 02/04/2016
25 368835 UTSW Ikbkap 1.000 R4794 G1 114 N 4 56781176 ACTTCTTCTTCTTCTTCTTCTTC ACTTCTTCTTCTTCTTCTTC small deletion Het probably benign phenotype 02/04/2016
26 368881 UTSW Kalrn 0.923 R4794 G1 186 Y 16 33989810 D2525N C T missense Het possibly damaging 0.722 0.091 phenotype 02/04/2016
27 368818 UTSW Kif1a 0.828 R4794 G1 225 Y 1 93025727 Y1245C T C missense Het probably damaging 1.000 0.304 phenotype 02/04/2016
28 368886 UTSW Ltbp3 0.272 R4794 G1 197 Y 19 5756679 F1022L T C missense Het probably damaging 0.995 0.574 phenotype 02/04/2016
29 368866 UTSW Med16 1.000 R4794 G1 225 Y 10 79900117 T399N G T missense Het probably damaging 0.997 0.647 02/04/2016
30 368833 UTSW Mfsd14a 0.570 R4794 G1 225 Y 3 116645506 A T intron Het probably benign phenotype 02/04/2016
31 368827 UTSW Myh7b 0.000 R4794 G1 225 Y 2 155623266 V681I G A missense Het probably benign 0.002 0.081 phenotype 02/04/2016
32 404197 UTSW Ndc1 0.951 R4794 G1 225 Y 4 107390222 E409G A G missense Het probably benign 0.030 0.064 phenotype 07/22/2016
33 368837 UTSW Necap2 0.117 R4794 G1 225 Y 4 141071601 A G intron Het probably benign 0.090 phenotype 02/04/2016
34 368848 UTSW Olfr47 0.073 R4794 G1 225 Y 6 43235695 L29H T A missense Het probably damaging 0.999 0.647 phenotype 02/04/2016
35 368860 UTSW Olfr847 0.134 R4794 G1 225 Y 9 19375545 S112N C T missense Het probably benign 0.002 0.087 phenotype 02/04/2016
36 368847 UTSW Parp12 0.109 R4794 G1 189 Y 6 39117810 T117I G A missense Het probably benign 0.023 0.090 02/04/2016
37 368836 UTSW Pars2 0.852 R4794 G1 225 Y 4 106654210 C396* C A nonsense Het probably null 0.976 phenotype 02/04/2016
38 368819 UTSW Prg4 0.131 R4794 G1 225 Y 1 150454546 A T intron Het probably benign 0.132 phenotype 02/04/2016
39 368842 UTSW Prkg2 0.172 R4794 G1 225 Y 5 98966633 T523I G A missense Het probably damaging 0.995 0.328 phenotype 02/04/2016
40 368880 UTSW Prph 0.159 R4794 G1 225 Y 15 99057427 L425Q T A missense Het probably damaging 1.000 0.929 phenotype 02/04/2016
41 368874 UTSW Ranbp9 0.951 R4794 G1 225 Y 13 43414076 Y549H A G missense Het probably damaging 0.988 0.082 phenotype 02/04/2016
42 368828 UTSW Rbm12 0.892 R4794 G1 225 Y 2 156095569 A T intron Het probably benign 0.060 phenotype 02/04/2016
43 368839 UTSW Reln 0.940 R4794 G1 225 Y 5 22344185 Y75C T C missense Het probably damaging 0.979 0.646 phenotype 02/04/2016
44 368871 UTSW Rock2 0.855 R4794 G1 214 Y 12 16940407 R110H G A missense Het probably damaging 1.000 0.414 phenotype 02/04/2016
45 404199 UTSW Samd1 0.894 R4794 G1 225 Y 8 83999717 E468K G A missense Het probably damaging 0.999 0.337 07/22/2016
46 368838 UTSW Samd11 0.107 R4794 G1 225 Y 4 156249465 Q173L T A missense Het probably damaging 0.976 0.114 02/04/2016
47 368856 UTSW Scgb2b20 0.075 R4794 G1 225 Y 7 33365726 G37V C A missense Het probably damaging 1.000 0.647 02/04/2016
48 368887 UTSW Sf1 1.000 R4794 G1 191 N 19 6375664 C A unclassified Het probably benign phenotype 02/04/2016
49 368861 UTSW Slc17a5 0.122 R4794 G1 225 Y 9 78574715 H183L T A missense Het probably damaging 0.963 0.623 phenotype 02/04/2016
50 368879 UTSW Smgc 0.066 R4794 G1 225 Y 15 91841454 S13T T A missense Het probably benign 0.271 0.090 02/04/2016
51 368831 UTSW Snapin 1.000 R4794 G1 225 Y 3 90490785 A G intron Het probably benign 0.090 phenotype 02/04/2016
52 368855 UTSW Ssc5d 0.000 R4794 G1 225 Y 7 4943745 P1033S C T missense Het probably benign 0.000 0.090 02/04/2016
53 368872 UTSW Strn3 1.000 R4794 G1 225 Y 12 51650171 E259G T C missense Het probably benign 0.383 0.065 02/04/2016
54 368865 UTSW Tbc1d32 0.870 R4794 G1 225 Y 10 56196836 F238L A G missense Het possibly damaging 0.922 0.085 phenotype 02/04/2016
55 368834 UTSW Tbck 0.240 R4794 G1 225 Y 3 132686968 V57M G A missense Het possibly damaging 0.900 0.136 phenotype 02/04/2016
56 368826 UTSW Tgm3 0.000 R4794 G1 225 Y 2 130041955 D511G A G missense Het probably benign 0.001 0.073 phenotype 02/04/2016
57 368821 UTSW Tlr5 0.242 R4794 G1 225 Y 1 182973896 V241A T C missense Het probably benign 0.004 0.099 phenotype 02/04/2016
58 368882 UTSW Tmem181c-ps 0.327 R4794 G1 225 Y 17 6620355 A G exon Het noncoding transcript 0.934 02/04/2016
59 368852 UTSW Tnfrsf1a 0.000 R4794 G1 225 Y 6 125358084 C168Y G A missense Het probably damaging 1.000 0.945 phenotype 02/04/2016
60 368867 UTSW Tph2 0.313 R4794 G1 225 Y 10 115182770 L79I G T missense Het possibly damaging 0.838 0.179 phenotype 02/04/2016
61 368822 UTSW Tsc1 1.000 R4794 G1 225 Y 2 28661690 G A splice site 5 bp Het probably null 0.976 phenotype 02/04/2016
62 368830 UTSW Ttc14 0.348 R4794 G1 225 Y 3 33803149 M215L A T missense Het probably benign 0.005 0.090 02/04/2016
63 368841 UTSW Ube3c 0.000 R4794 G1 225 Y 5 29597085 N120S A G missense Het probably benign 0.064 0.061 02/04/2016
64 368884 UTSW Ubr2 0.867 R4794 G1 225 Y 17 46930445 W1728R A T missense Het probably damaging 1.000 0.928 phenotype 02/04/2016
65 368864 UTSW Vnn1 0.108 R4794 G1 225 Y 10 23900704 T318A A G missense Het probably benign 0.012 0.067 phenotype 02/04/2016
66 368850 UTSW Washc2 1.000 R4794 G1 225 Y 6 116258649 V941A T C missense Het probably benign 0.028 0.085 02/04/2016
67 368843 UTSW Wdfy3 0.916 R4794 G1 225 Y 5 101943943 V510A A G missense Het probably damaging 0.998 0.153 phenotype 02/04/2016
68 368823 UTSW Wdsub1 0.138 R4794 G1 225 Y 2 59862844 V272E A T missense Het possibly damaging 0.780 0.179 02/04/2016
69 368857 UTSW Xylt1 0.458 R4794 G1 225 Y 7 117637635 D537A A C missense Het probably benign 0.066 0.163 phenotype 02/04/2016
70 368883 UTSW Zfp57 0.388 R4794 G1 225 Y 17 37010130 N292S A G missense Het possibly damaging 0.522 0.165 phenotype 02/04/2016
[records 1 to 70 of 70]