Incidental Mutations

70 incidental mutations are currently displayed, and affect 70 genes.
8 are Possibly Damaging.
27 are Probably Damaging.
30 are Probably Benign.
4 are Probably Null.
2 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 70 of 70] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 368873 UTSW Adam4 0.061 R4794 G1 225 Y 12 81421424 (GRCm38) I141K A T missense Het probably damaging 0.993 0.647 2016-02-04
2 368877 UTSW Adgrb1 0.000 R4794 G1 225 Y 15 74588129 (GRCm38) E537G A G missense Het probably damaging 1.000 0.251 phenotype 2016-02-04
3 368840 UTSW Asic3 0.086 R4794 G1 225 Y 5 24415897 (GRCm38) A259V C T missense Het probably damaging 0.964 0.647 phenotype 2016-02-04
4 368859 UTSW Bcar1 1.000 R4794 G1 225 Y 8 111720920 (GRCm38) Q142* G A nonsense Het probably null 0.976 phenotype 2016-02-04
5 368868 UTSW Bcas3 0.762 R4794 G1 225 Y 11 85509468 (GRCm38) V200A T C missense Het probably damaging 0.999 0.073 2016-02-04
6 368824 UTSW Cd302 0.110 R4794 G1 225 Y 2 60272149 (GRCm38) I42N A T missense Het probably benign 0.063 0.085 phenotype 2016-02-04
7 368885 UTSW Colec12 0.304 R4794 G1 225 Y 18 9848984 (GRCm38) N387K C A missense Het probably damaging 0.988 0.647 phenotype 2016-02-04
8 368820 UTSW Copa 0.969 R4794 G1 225 Y 1 172119321 (GRCm38) I1032N T A missense Het probably damaging 1.000 0.747 phenotype 2016-02-04
9 368829 UTSW D630003M21Rik 0.063 R4794 G1 225 Y 2 158196139 (GRCm38) T1129S G C missense Het probably benign 0.000 0.090 2016-02-04
10 368846 UTSW D630045J12Rik 0.000 R4794 G1 225 Y 6 38194485 (GRCm38) T916I G A missense Het possibly damaging 0.899 0.179 phenotype 2016-02-04
11 404198 UTSW Dnajb13 0.213 R4794 G1 225 Y 7 100503992 (GRCm38) A241T C T missense Het probably damaging 1.000 phenotype 2016-07-22
12 368853 UTSW Dyrk4 0.000 R4794 G1 225 Y 6 126885337 (GRCm38) N397K G T missense Het possibly damaging 0.792 0.179 phenotype 2016-02-04
13 368869 UTSW Eftud2 1.000 R4794 G1 225 Y 11 102870177 (GRCm38) Y114F T A missense Het probably benign 0.139 0.068 phenotype 2016-02-04
14 368862 UTSW Epm2a 0.211 R4794 G1 225 Y 10 11390853 (GRCm38) D114G A G missense Het probably benign 0.015 0.090 phenotype 2016-02-04
15 404200 UTSW Exoc5 0.951 R4794 G1 225 Y 14 49048900 (GRCm38) T C critical splice acceptor site Het probably null 0.950 phenotype 2016-07-22
16 368817 UTSW Fam135a 0.130 R4794 G1 225 Y 1 24029160 (GRCm38) T706I G A missense Het probably benign 0.363 0.090 2016-02-04
17 368870 UTSW Fasn 1.000 R4794 G1 225 Y 11 120811295 (GRCm38) V1845A A G missense Het probably benign 0.364 0.117 phenotype 2016-02-04
18 368845 UTSW Fscn3 0.202 R4794 G1 225 Y 6 28430596 (GRCm38) E255G A G missense Het probably damaging 1.000 0.603 2016-02-04
19 368858 UTSW Galnt7 0.732 R4794 G1 225 Y 8 57545363 (GRCm38) Y311N A T missense Het probably damaging 0.996 0.470 phenotype 2016-02-04
20 368825 UTSW Gm13757 0.060 R4794 G1 225 Y 2 88446347 (GRCm38) M197K A T missense Het probably benign 0.117 0.090 2016-02-04
21 368854 UTSW Gm5724 0.066 R4794 G1 225 Y 6 141767562 (GRCm38) V31A A G missense Het probably benign 0.114 0.115 2016-02-04
22 368875 UTSW Gm8765 0.060 R4794 G1 225 Y 13 50703239 (GRCm38) P971R C G missense Het probably benign 0.069 0.090 2016-02-04
23 368876 UTSW Grid1 0.061 R4794 G1 225 Y 14 34822622 (GRCm38) L50P T C missense Het probably damaging 0.994 0.134 phenotype 2016-02-04
24 368844 UTSW Hepacam2 0.194 R4794 G1 225 Y 6 3475933 (GRCm38) F331L A G missense Het probably damaging 0.960 0.250 phenotype 2016-02-04
25 368835 UTSW Ikbkap 1.000 R4794 G1 114 N 4 56781176 (GRCm38) ACTTCTTCTTCTTCTTCTTCTTC ACTTCTTCTTCTTCTTCTTC small deletion Het probably benign phenotype 2016-02-04
26 368881 UTSW Kalrn 0.921 R4794 G1 186 Y 16 33989810 (GRCm38) D2525N C T missense Het possibly damaging 0.722 0.091 phenotype 2016-02-04
27 368818 UTSW Kif1a 0.905 R4794 G1 225 Y 1 93025727 (GRCm38) Y1245C T C missense Het probably damaging 1.000 0.304 phenotype 2016-02-04
28 368886 UTSW Ltbp3 0.190 R4794 G1 197 Y 19 5756679 (GRCm38) F1022L T C missense Het probably damaging 0.995 0.574 phenotype 2016-02-04
29 368866 UTSW Med16 1.000 R4794 G1 225 Y 10 79900117 (GRCm38) T399N G T missense Het probably damaging 0.997 0.647 2016-02-04
30 368833 UTSW Mfsd14a 0.549 R4794 G1 225 Y 3 116645506 (GRCm38) A T intron Het probably benign phenotype 2016-02-04
31 368827 UTSW Myh7b 0.000 R4794 G1 225 Y 2 155623266 (GRCm38) V681I G A missense Het probably benign 0.002 0.081 phenotype 2016-02-04
32 404197 UTSW Ndc1 0.935 R4794 G1 225 Y 4 107390222 (GRCm38) E409G A G missense Het probably benign 0.030 0.064 phenotype 2016-07-22
33 368837 UTSW Necap2 0.097 R4794 G1 225 Y 4 141071601 (GRCm38) A G intron Het probably benign 0.090 phenotype 2016-02-04
34 368848 UTSW Olfr47 0.065 R4794 G1 225 Y 6 43235695 (GRCm38) L29H T A missense Het probably damaging 0.999 0.647 phenotype 2016-02-04
35 368860 UTSW Olfr847 0.132 R4794 G1 225 Y 9 19375545 (GRCm38) S112N C T missense Het probably benign 0.002 0.087 phenotype 2016-02-04
36 368847 UTSW Parp12 0.213 R4794 G1 189 Y 6 39117810 (GRCm38) T117I G A missense Het probably benign 0.023 0.090 2016-02-04
37 368836 UTSW Pars2 0.900 R4794 G1 225 Y 4 106654210 (GRCm38) C396* C A nonsense Het probably null 0.976 phenotype 2016-02-04
38 368819 UTSW Prg4 0.134 R4794 G1 225 Y 1 150454546 (GRCm38) A T intron Het probably benign 0.132 phenotype 2016-02-04
39 368842 UTSW Prkg2 0.114 R4794 G1 225 Y 5 98966633 (GRCm38) T523I G A missense Het probably damaging 0.995 0.328 phenotype 2016-02-04
40 368880 UTSW Prph 0.083 R4794 G1 225 Y 15 99057427 (GRCm38) L425Q T A missense Het probably damaging 1.000 0.929 phenotype 2016-02-04
41 368874 UTSW Ranbp9 0.950 R4794 G1 225 Y 13 43414076 (GRCm38) Y549H A G missense Het probably damaging 0.988 0.082 phenotype 2016-02-04
42 368828 UTSW Rbm12 0.894 R4794 G1 225 Y 2 156095569 (GRCm38) A T intron Het probably benign 0.060 phenotype 2016-02-04
43 368839 UTSW Reln 0.960 R4794 G1 225 Y 5 22344185 (GRCm38) Y75C T C missense Het probably damaging 0.979 0.646 phenotype 2016-02-04
44 368871 UTSW Rock2 0.902 R4794 G1 214 Y 12 16940407 (GRCm38) R110H G A missense Het probably damaging 1.000 0.414 phenotype 2016-02-04
45 404199 UTSW Samd1 0.866 R4794 G1 225 Y 8 83999717 (GRCm38) E468K G A missense Het probably damaging 0.999 0.337 2016-07-22
46 368838 UTSW Samd11 0.168 R4794 G1 225 Y 4 156249465 (GRCm38) Q173L T A missense Het probably damaging 0.976 0.114 2016-02-04
47 368856 UTSW Scgb2b20 0.060 R4794 G1 225 Y 7 33365726 (GRCm38) G37V C A missense Het probably damaging 1.000 0.647 2016-02-04
48 368887 UTSW Sf1 1.000 R4794 G1 191 N 19 6375664 (GRCm38) C A unclassified Het probably benign phenotype 2016-02-04
49 368861 UTSW Slc17a5 0.834 R4794 G1 225 Y 9 78574715 (GRCm38) H183L T A missense Het probably damaging 0.963 0.623 phenotype 2016-02-04
50 368879 UTSW Smgc 0.066 R4794 G1 225 Y 15 91841454 (GRCm38) S13T T A missense Het probably benign 0.271 0.090 2016-02-04
51 368831 UTSW Snapin 1.000 R4794 G1 225 Y 3 90490785 (GRCm38) A G intron Het probably benign 0.090 phenotype 2016-02-04
52 368855 UTSW Ssc5d 0.000 R4794 G1 225 Y 7 4943745 (GRCm38) P1033S C T missense Het probably benign 0.000 0.090 2016-02-04
53 368872 UTSW Strn3 1.000 R4794 G1 225 Y 12 51650171 (GRCm38) E259G T C missense Het probably benign 0.383 0.065 2016-02-04
54 368865 UTSW Tbc1d32 0.906 R4794 G1 225 Y 10 56196836 (GRCm38) F238L A G missense Het possibly damaging 0.922 0.085 phenotype 2016-02-04
55 368834 UTSW Tbck 0.322 R4794 G1 225 Y 3 132686968 (GRCm38) V57M G A missense Het possibly damaging 0.900 0.136 phenotype 2016-02-04
56 368826 UTSW Tgm3 0.000 R4794 G1 225 Y 2 130041955 (GRCm38) D511G A G missense Het probably benign 0.001 0.073 phenotype 2016-02-04
57 368821 UTSW Tlr5 0.290 R4794 G1 225 Y 1 182973896 (GRCm38) V241A T C missense Het probably benign 0.004 0.099 phenotype 2016-02-04
58 368882 UTSW Tmem181c-ps 0.518 R4794 G1 225 Y 17 6620355 (GRCm38) A G exon Het noncoding transcript 0.934 2016-02-04
59 368852 UTSW Tnfrsf1a 0.000 R4794 G1 225 Y 6 125358084 (GRCm38) C168Y G A missense Het probably damaging 1.000 0.945 phenotype 2016-02-04
60 368867 UTSW Tph2 0.263 R4794 G1 225 Y 10 115182770 (GRCm38) L79I G T missense Het possibly damaging 0.838 0.179 phenotype 2016-02-04
61 368822 UTSW Tsc1 1.000 R4794 G1 225 Y 2 28661690 (GRCm38) G A splice site 5 bp Het probably null 0.976 phenotype 2016-02-04
62 368830 UTSW Ttc14 0.091 R4794 G1 225 Y 3 33803149 (GRCm38) M215L A T missense Het probably benign 0.005 0.090 2016-02-04
63 368841 UTSW Ube3c 0.000 R4794 G1 225 Y 5 29597085 (GRCm38) N120S A G missense Het probably benign 0.064 0.061 2016-02-04
64 368884 UTSW Ubr2 0.934 R4794 G1 225 Y 17 46930445 (GRCm38) W1728R A T missense Het probably damaging 1.000 0.928 phenotype 2016-02-04
65 368864 UTSW Vnn1 0.120 R4794 G1 225 Y 10 23900704 (GRCm38) T318A A G missense Het probably benign 0.012 0.067 phenotype 2016-02-04
66 368850 UTSW Washc2 1.000 R4794 G1 225 Y 6 116258649 (GRCm38) V941A T C missense Het probably benign 0.028 0.085 2016-02-04
67 368843 UTSW Wdfy3 0.936 R4794 G1 225 Y 5 101943943 (GRCm38) V510A A G missense Het probably damaging 0.998 0.153 phenotype 2016-02-04
68 368823 UTSW Wdsub1 0.093 R4794 G1 225 Y 2 59862844 (GRCm38) V272E A T missense Het possibly damaging 0.780 0.179 2016-02-04
69 368857 UTSW Xylt1 0.181 R4794 G1 225 Y 7 117637635 (GRCm38) D537A A C missense Het probably benign 0.066 0.163 phenotype 2016-02-04
70 368883 UTSW Zfp57 0.353 R4794 G1 225 Y 17 37010130 (GRCm38) N292S A G missense Het possibly damaging 0.522 0.165 phenotype 2016-02-04
[records 1 to 70 of 70]