Incidental Mutations

86 incidental mutations are currently displayed, and affect 84 genes.
13 are Possibly Damaging.
32 are Probably Damaging.
27 are Probably Benign.
13 are Probably Null.
3 create premature stop codons.
4 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 86 of 86] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 374550 UTSW Aebp2 1.000 R4856 G1 225 N 6 140644073 G A critical splice donor site 1 bp Het probably null phenotype 03/16/2016
2 374007 UTSW Arsi 0.094 R4856 G1 225 N 18 60916651 G202E G A missense Het probably benign 0.068 0.063 phenotype 03/01/2016
3 373925 UTSW Atp2b4 0.306 R4856 G1 225 N 1 133706780 I1177L T A missense Het probably benign 0.001 phenotype 03/01/2016
4 373964 UTSW Bub3 1.000 R4856 G1 225 N 7 131561568 D76V A T missense Het probably damaging 1.000 phenotype 03/01/2016
5 373955 UTSW Cacna2d4 0.000 R4856 G1 225 N 6 119278256 R578Q G A missense Het possibly damaging 0.896 phenotype 03/01/2016
6 373958 UTSW Caprin2 0.000 R4856 G1 225 N 6 148873011 S268A A C missense Het probably benign 0.190 phenotype 03/01/2016
7 374554 UTSW Card6 0.000 R4856 G1 225 N 15 5105141 T C splice site Het probably null phenotype 03/16/2016
8 373988 UTSW Cdk13 1.000 R4856 G1 225 N 13 17719734 S1103P A G missense Het probably benign 0.000 phenotype 03/01/2016
9 373923 UTSW Cfap221 0.000 R4856 G1 225 N 1 119934204 T614A T C missense Het probably damaging 0.992 03/01/2016
10 373924 UTSW Cfap221 0.000 R4856 G1 160 N 1 119984758 Y133F T A missense Het probably damaging 0.992 03/01/2016
11 373936 UTSW Clcc1 1.000 R4856 G1 225 N 3 108676838 T513A A G missense Het probably benign 0.019 phenotype 03/01/2016
12 373965 UTSW Clec4g 0.000 R4856 G1 225 N 8 3716419 T A intron Het probably benign phenotype 03/01/2016
13 373942 UTSW Cntln 0.316 R4856 G1 225 N 4 84971229 E316D A C missense Het probably benign 0.351 03/01/2016
14 373968 UTSW Cpne2 0.115 R4856 G1 225 N 8 94563964 D392E T A missense Het probably benign 0.001 phenotype 03/01/2016
15 373981 UTSW Cry1 0.000 R4856 G1 225 N 10 85148770 P147T G T missense Het probably damaging 0.968 phenotype 03/01/2016
16 373944 UTSW Cyp4a29 0.087 R4856 G1 225 N 4 115252881 V440A T C missense Het probably benign 0.000 03/01/2016
17 373994 UTSW Ddx46 0.963 R4856 G1 150 N 13 55638199 D64G A G missense Het unknown phenotype 03/01/2016
18 373961 UTSW Dhx34 0.518 R4856 G1 116 N 7 16215442 S354P A G missense Het possibly damaging 0.938 phenotype 03/01/2016
19 373993 UTSW Ecm2 0.158 R4856 G1 225 N 13 49522787 I327F A T missense Het possibly damaging 0.465 phenotype 03/01/2016
20 373971 UTSW Elavl3 0.382 R4856 G1 225 N 9 22026318 K189E T C missense Het possibly damaging 0.643 phenotype 03/01/2016
21 373949 UTSW Enam 0.305 R4856 G1 225 N 5 88488734 R82* A T nonsense Het probably null phenotype 03/01/2016
22 373962 UTSW Erf 1.000 R4856 G1 225 N 7 25246211 V45A A G missense Het probably damaging 0.987 phenotype 03/01/2016
23 373970 UTSW Fat3 0.513 R4856 G1 225 N 9 16021330 I1436F T A missense Het probably benign 0.000 phenotype 03/01/2016
24 373953 UTSW Flnc 1.000 R4856 G1 225 N 6 29447890 Y1231H T C missense Het probably damaging 0.996 phenotype 03/01/2016
25 373930 UTSW Ggta1 0.000 R4856 G1 225 N 2 35402791 H180L T A missense Het possibly damaging 0.594 phenotype 03/01/2016
26 373946 UTSW Gm13103 0.068 R4856 G1 225 N 4 143853303 R486L G T missense Het probably benign 0.002 03/01/2016
27 373984 UTSW Grin2c 0.334 R4856 G1 225 N 11 115260790 T115A T C missense Het probably damaging 1.000 phenotype 03/01/2016
28 373947 UTSW H6pd 0.096 R4856 G1 225 N 4 149982778 V384M C T missense Het possibly damaging 0.475 phenotype 03/01/2016
29 373982 UTSW Hba-x R4856 G1 225 N 11 32277008 E39G A G missense Het probably benign 0.159 phenotype 03/01/2016
30 374008 UTSW Hnrnpul2 0.782 R4856 G1 225 N 19 8829827 P618S C T missense Het probably benign 0.202 03/01/2016
31 374010 UTSW Hpse2 0.350 R4856 G1 225 N 19 42788957 R590H C T missense Het probably damaging 0.998 phenotype 03/01/2016
32 373987 UTSW Ighv1-54 0.130 R4856 G1 225 N 12 115193803 G75C C A missense Het probably damaging 1.000 03/01/2016
33 472690 UTSW Ighv8-11 R4856 G1 225 N 12 115567154 R118L C A missense Het possibly damaging 0.885 04/14/2017
34 373967 UTSW Iqcm 0.067 R4856 G1 225 N 8 75888600 R436S A T missense Het possibly damaging 0.953 03/01/2016
35 373975 UTSW Islr 0.137 R4856 G1 225 N 9 58157606 D206G T C missense Het probably damaging 0.993 phenotype 03/01/2016
36 374552 UTSW Itih1 0.087 R4856 G1 225 N 14 30936701 A G critical splice donor site 2 bp Het probably null phenotype 03/16/2016
37 374000 UTSW Jam2 0.000 R4856 G1 225 N 16 84801602 D34N G A missense Het probably benign 0.393 phenotype 03/01/2016
38 374555 UTSW Klhl14 0.615 R4856 G1 225 N 18 21557972 A T splice site Het probably null phenotype 03/16/2016
39 373980 UTSW Lama2 0.334 R4856 G1 217 N 10 27043643 TTTGCGCATT TTT frame shift Het probably null 0.976 phenotype 03/01/2016
40 373948 UTSW Lrrc66 0.051 R4856 G1 225 N 5 73608567 F378L A G missense Het probably benign 0.105 03/01/2016
41 373969 UTSW Map10 0.081 R4856 G1 225 N 8 125670692 Y275N T A missense Het probably damaging 1.000 03/01/2016
42 373974 UTSW Mpi 1.000 R4856 G1 225 N 9 57545307 Y314C T C missense Het probably damaging 1.000 phenotype 03/01/2016
43 373983 UTSW Mpp3 0.000 R4856 G1 225 N 11 102025136 Y55H A G missense Het probably benign 0.000 phenotype 03/01/2016
44 373926 UTSW Nectin4 0.067 R4856 G1 225 N 1 171384815 V327A T C missense Het possibly damaging 0.460 phenotype 03/01/2016
45 373959 UTSW Nlrp12 0.160 R4856 G1 225 N 7 3240442 D480V T A missense Het probably damaging 0.999 phenotype 03/01/2016
46 374011 UTSW Nolc1 0.000 R4856 G1 137 N 19 46083155 GAGCAGCAGCAGCAGCAGCAGCAGCAGC GAGCAGCAGCAGCAGCAGCAGCAGC small deletion Het probably benign 03/01/2016
47 373935 UTSW Notch2 1.000 R4856 G1 225 N 3 98102419 Y554F A T missense Het probably damaging 0.999 phenotype 03/01/2016
48 373932 UTSW Nrsn2 0.055 R4856 G1 220 N 2 152369611 K167E T C missense Het probably benign 0.090 03/01/2016
49 373972 UTSW Olfr147 0.058 R4856 G1 225 N 9 38403468 N195I A T missense Het probably damaging 0.998 phenotype 03/01/2016
50 374556 UTSW Olfr1472 0.185 R4856 G1 225 N 19 13454521 T C splice site Het probably null phenotype 03/16/2016
51 374009 UTSW Olfr1501 0.063 R4856 G1 225 N 19 13838279 E298V T A missense Het probably damaging 0.993 phenotype 03/01/2016
52 373963 UTSW Olfr695 0.118 R4856 G1 225 N 7 106873970 I92F T A missense Het probably damaging 0.997 phenotype 03/01/2016
53 374005 UTSW Olfr761 0.110 R4856 G1 225 N 17 37952071 S318T A T missense Het probably benign 0.150 phenotype 03/01/2016
54 373957 UTSW Olr1 0.000 R4856 G1 225 N 6 129493596 K203* T A nonsense Het probably null phenotype 03/01/2016
55 373943 UTSW Osbpl9 0.000 R4856 G1 225 N 4 109068367 N485S T C missense Het probably benign 0.378 phenotype 03/01/2016
56 373995 UTSW Pbk 0.694 R4856 G1 225 N 14 65815201 H164Q T A missense Het probably damaging 1.000 phenotype 03/01/2016
57 373934 UTSW Pfn2 0.324 R4856 G1 145 N 3 57847453 N10K G T missense Het probably damaging 0.983 phenotype 03/01/2016
58 373933 UTSW Pik3ca 1.000 R4856 G1 225 N 3 32437163 D133G A G missense Het probably damaging 1.000 phenotype 03/01/2016
59 373991 UTSW Prl6a1 0.065 R4856 G1 225 N 13 27319000 D193V A T missense Het probably damaging 0.976 03/01/2016
60 373997 UTSW Rad21 1.000 R4856 G1 225 N 15 51968500 P395Q G T missense Het probably damaging 0.999 phenotype 03/01/2016
61 373979 UTSW Reps1 0.518 R4856 G1 225 N 10 18123625 I720N T A missense Het probably damaging 1.000 phenotype 03/01/2016
62 374549 UTSW Rpn2 1.000 R4856 G1 225 N 2 157318044 T C critical splice donor site 2 bp Het probably null phenotype 03/16/2016
63 373992 UTSW Rreb1 0.958 R4856 G1 225 N 13 37931058 V798M G A missense Het possibly damaging 0.623 phenotype 03/01/2016
64 373928 UTSW Sardh 0.112 R4856 G1 128 N 2 27244477 R9H C T missense Het probably benign 0.019 phenotype 03/01/2016
65 374006 UTSW Scgb3a2 0.055 R4856 G1 225 N 18 43766754 P36S C T missense Het probably damaging 0.999 phenotype 03/01/2016
66 373977 UTSW Scn10a 0.160 R4856 G1 225 N 9 119694309 G6V C A missense Het possibly damaging 0.458 phenotype 03/01/2016
67 373978 UTSW Scn10a 0.160 R4856 G1 225 N 9 119694310 G6R C T missense Het possibly damaging 0.628 phenotype 03/01/2016
68 373931 UTSW Scn3a 1.000 R4856 G1 225 N 2 65461032 D1790G T C missense Het probably damaging 1.000 phenotype 03/01/2016
69 373938 UTSW Sec24b 0.826 R4856 G1 225 N 3 129983970 H1226Q A T missense Het probably benign 0.074 phenotype 03/01/2016
70 373950 UTSW Shroom3 1.000 R4856 G1 225 N 5 92943086 V1151F G T missense Het probably damaging 0.997 0.647 phenotype 03/01/2016
71 374551 UTSW Slc12a3 0.000 R4856 G1 225 N 8 94351810 G A critical splice donor site 1 bp Het probably null phenotype 03/16/2016
72 373996 UTSW Slitrk6 0.146 R4856 G1 225 N 14 110751883 T131A T C missense Het probably damaging 1.000 0.267 phenotype 03/01/2016
73 373940 UTSW Spata1 0.114 R4856 G1 225 N 3 146469774 D326H C G missense Het probably damaging 0.990 0.647 03/01/2016
74 373990 UTSW Tcrg-V4 R4856 G1 225 N 13 19185066 V29A T C missense Het probably benign 0.015 03/01/2016
75 373956 UTSW Tex52 0.067 R4856 G1 225 N 6 128384988 A T splice site 507 bp Het probably null 03/01/2016
76 373966 UTSW Tma16 0.937 R4856 G1 225 N 8 66481477 C75W A C missense Het probably damaging 0.998 03/01/2016
77 373941 UTSW Tmem67 1.000 R4856 G1 225 N 4 12089416 G A unclassified Het probably benign phenotype 03/01/2016
78 373939 UTSW Trmt10a 0.000 R4856 G1 225 N 3 138148385 K75* A T nonsense Het probably null phenotype 03/01/2016
79 374001 UTSW Ttc3 0.724 R4856 G1 225 N 16 94390283 V228A T C missense Het probably benign 0.323 03/01/2016
80 472688 UTSW Ttn 1.000 R4856 G1 225 N 2 76731300 D28954G T C missense Het probably damaging 1.000 phenotype 04/14/2017
81 374553 UTSW Uggt2 0.104 R4856 G1 225 N 14 119035964 A G splice site 6 bp Het probably null phenotype 03/16/2016
82 374003 UTSW Vars 0.967 R4856 G1 152 N 17 35015726 V1177E T A missense Het probably benign 0.374 phenotype 03/01/2016
83 373960 UTSW Vmn1r59 0.062 R4856 G1 225 N 7 5454533 D76G T C missense Het possibly damaging 0.916 03/01/2016
84 374002 UTSW Vmn2r114 0.110 R4856 G1 225 N 17 23308034 A508E G T missense Het probably benign 0.114 03/01/2016
85 373989 UTSW Vps41 1.000 R4856 G1 225 N 13 18829255 V348M G A missense Het probably damaging 0.981 phenotype 03/01/2016
86 373929 UTSW Zbtb43 0.000 R4856 G1 225 N 2 33453932 H427R T C missense Het probably damaging 0.999 03/01/2016
[records 1 to 86 of 86]