Incidental Mutations

99 incidental mutations are currently displayed, and affect 98 genes.
23 are Possibly Damaging.
43 are Probably Damaging.
31 are Probably Benign.
1 are Probably Null.
0 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 99 of 99] per page Full List
ID question?
Source question?
Gene question?
E-score question?
Stock # question?
Gen question?
Vld question?
Strain question?
Chr question?
Position question?
Mutation question?
Type question?
Exon Dist question?
Zygosity question?
Predicted Effect question?
PPH Score question?
Meta Score question?
MGI Phenotype question?
Posted question?
1 378563 UTSW 4930522L14Rik 0.138 R4921 G1 225 N 5 109737796 N65K A T missense Het probably benign 0.253 04/15/2016
2 378573 UTSW Abcc9 0.118 R4921 G1 225 N 6 142590436 Y1524C T C missense Het probably benign 0.000 phenotype 04/15/2016
3 378615 UTSW Acap1 0.000 R4921 G1 225 N 11 69887193 I102T A G missense Het probably damaging 0.975 04/15/2016
4 378543 UTSW Acvr2a 0.000 R4921 G1 225 N 2 48893541 V284A T C missense Het possibly damaging 0.511 phenotype 04/15/2016
5 378587 UTSW Adam3 0.000 R4921 G1 225 N 8 24684614 M712V T C missense Het probably benign 0.008 phenotype 04/15/2016
6 378622 UTSW Adck1 0.000 R4921 G1 225 N 12 88441138 V213A T C missense Het probably benign 0.101 04/15/2016
7 378559 UTSW Adgrl3 0.000 R4921 G1 225 N 5 81512110 W242L G T missense Het probably damaging 1.000 phenotype 04/15/2016
8 378648 UTSW Alk 0.170 R4921 G1 225 N 17 71904315 T857A T C missense Het probably benign 0.302 phenotype 04/15/2016
9 378570 UTSW Alms1 0.000 R4921 G1 225 N 6 85628546 T2393A A G missense Het probably benign 0.127 phenotype 04/15/2016
10 378609 UTSW Ank3 0.845 R4921 G1 225 N 10 70002109 P240L C T missense Het probably damaging 0.999 phenotype 04/15/2016
11 378549 UTSW Ankrd35 0.000 R4921 G1 146 N 3 96684824 L809M C A missense Het possibly damaging 0.609 04/15/2016
12 378649 UTSW Birc6 1.000 R4921 G1 225 N 17 74650099 L3690Q T A missense Het probably damaging 1.000 phenotype 04/15/2016
13 378561 UTSW Bmp3 0.000 R4921 G1 225 N 5 98872061 F114L C A missense Het probably damaging 1.000 phenotype 04/15/2016
14 378625 UTSW Cage1 0.104 R4921 G1 225 N 13 38019208 H627Y G A missense Het probably benign 0.332 04/15/2016
15 378585 UTSW Cars 1.000 R4921 G1 225 N 7 143569475 D468G T C missense Het probably damaging 0.999 phenotype 04/15/2016
16 378544 UTSW Ccdc148 0.076 R4921 G1 225 N 2 58829802 E487G T C missense Het probably damaging 1.000 04/15/2016
17 378639 UTSW Ccdc80 0.099 R4921 G1 225 N 16 45118167 I746F A T missense Het probably damaging 0.999 phenotype 04/15/2016
18 378586 UTSW Ccl25 0.063 R4921 G1 180 N 8 4353913 Q119R A G missense Het possibly damaging 0.920 phenotype 04/15/2016
19 378631 UTSW Cdh24 0.224 R4921 G1 225 N 14 54633215 D178N C T missense Het probably damaging 1.000 04/15/2016
20 378616 UTSW Cdk12 1.000 R4921 G1 225 N 11 98222687 T766S A T missense Het unknown phenotype 04/15/2016
21 378583 UTSW Chst15 0.064 R4921 G1 222 N 7 132247884 T443S T A missense Het probably benign 0.007 phenotype 04/15/2016
22 378572 UTSW Cnbp 1.000 R4921 G1 225 N 6 87845146 D125G T C missense Het possibly damaging 0.941 phenotype 04/15/2016
23 378539 UTSW Cntn2 0.240 R4921 G1 225 N 1 132516032 V1003E A T missense Het possibly damaging 0.485 phenotype 04/15/2016
24 378548 UTSW Crct1 0.057 R4921 G1 222 N 3 93014825 A G unclassified Het probably benign 04/15/2016
25 378593 UTSW Dand5 0.070 R4921 G1 225 N 8 84816484 C121Y C T missense Het probably damaging 1.000 phenotype 04/15/2016
26 378576 UTSW Dmkn 0.066 R4921 G1 225 N 7 30771233 D382V A T missense Het probably damaging 0.988 phenotype 04/15/2016
27 378552 UTSW Dnase2b 0.071 R4921 G1 225 N 3 146593441 T86S T A missense Het probably damaging 1.000 phenotype 04/15/2016
28 378584 UTSW Dusp8 0.194 R4921 G1 101 N 7 142082154 GCCACCACCACCACCACCACCACC GCCACCACCACCACCACCACC unclassified Het probably benign phenotype 04/15/2016
29 378632 UTSW Eef1akmt1 0.000 R4921 G1 122 N 14 57550632 V90M C T missense Het probably damaging 0.972 04/15/2016
30 378542 UTSW Egfl7 0.286 R4921 G1 225 N 2 26590980 W168L G T missense Het probably benign 0.047 phenotype 04/15/2016
31 378565 UTSW Ep400 1.000 R4921 G1 225 N 5 110665810 C2908R A G missense Het probably damaging 0.999 phenotype 04/15/2016
32 378635 UTSW Espl1 1.000 R4921 G1 225 N 15 102315241 K1076E A G missense Het probably damaging 0.980 phenotype 04/15/2016
33 378569 UTSW Exoc4 1.000 R4921 G1 225 N 6 33910517 N747D A G missense Het probably benign 0.000 phenotype 04/15/2016
34 378621 UTSW Fancm 0.912 R4921 G1 225 N 12 65077141 V191A T C missense Het probably benign 0.191 phenotype 04/15/2016
35 378574 UTSW Fbxo17 0.064 R4921 G1 196 N 7 28732789 D97G A G missense Het probably benign 0.141 phenotype 04/15/2016
36 378634 UTSW Fer1l6 0.080 R4921 G1 225 N 15 58600311 G T critical splice acceptor site Het probably null 04/15/2016
37 378613 UTSW Flt4 1.000 R4921 G1 225 N 11 49627143 W337R T C missense Het probably damaging 0.977 phenotype 04/15/2016
38 378640 UTSW Fpr-rs7 0.100 R4921 G1 225 N 17 20113820 H136R T C missense Het possibly damaging 0.701 04/15/2016
39 378592 UTSW Frem3 0.121 R4921 G1 225 N 8 80613136 I686N T A missense Het possibly damaging 0.828 phenotype 04/15/2016
40 378564 UTSW Galnt9 0.094 R4921 G1 225 N 5 110577449 K84R A G missense Het probably damaging 0.957 phenotype 04/15/2016
41 378627 UTSW Gfm2 0.599 R4921 G1 225 N 13 97175676 M760K T A missense Het probably damaging 0.986 phenotype 04/15/2016
42 378656 UTSW Glis3 0.225 R4921 G1 195 N 19 28666104 T13A T C missense Het probably damaging 0.995 phenotype 04/15/2016
43 378555 UTSW Gm13078 0.150 R4921 G1 225 N 4 143728326 K398M A T missense Het possibly damaging 0.949 04/15/2016
44 378645 UTSW H2-K1 0.108 R4921 G1 225 N 17 33997076 V323A A G missense Het possibly damaging 0.651 phenotype 04/15/2016
45 378582 UTSW Hbb-bs 0.373 R4921 G1 88 N 7 103826720 A130V G A missense Het probably damaging 0.980 phenotype 04/15/2016
46 378579 UTSW Herc2 0.958 R4921 G1 225 N 7 56229690 H4685Q T A missense Het probably benign 0.037 phenotype 04/15/2016
47 378623 UTSW Ighv5-9-1 0.124 R4921 G1 225 N 12 113736294 R56H C T missense Het possibly damaging 0.606 04/15/2016
48 378618 UTSW Itgb4 1.000 R4921 G1 225 N 11 116006605 N1548S A G missense Het probably benign 0.115 phenotype 04/15/2016
49 378642 UTSW Itpr3 0.000 R4921 G1 225 N 17 27098005 Y745H T C missense Het probably damaging 0.999 phenotype 04/15/2016
50 378644 UTSW Kank3 0.083 R4921 G1 225 N 17 33817200 G14V G T missense Het probably damaging 1.000 04/15/2016
51 378553 UTSW Kif24 0.000 R4921 G1 225 N 4 41394329 S982Y G T missense Het probably damaging 0.985 phenotype 04/15/2016
52 378641 UTSW Kifc5b 0.434 R4921 G1 225 N 17 26921023 R53W C T missense Het probably damaging 0.999 04/15/2016
53 378617 UTSW Krt39 0.062 R4921 G1 225 N 11 99514749 S442P A G missense Het possibly damaging 0.799 phenotype 04/15/2016
54 378595 UTSW Lcat 0.296 R4921 G1 225 N 8 105942442 P67L G A missense Het possibly damaging 0.921 phenotype 04/15/2016
55 378600 UTSW Maml2 0.000 R4921 G1 225 N 9 13621175 S562P T C missense Het probably damaging 0.999 04/15/2016
56 378650 UTSW Map3k8 0.000 R4921 G1 225 N 18 4349124 R65W G A missense Het possibly damaging 0.919 phenotype 04/15/2016
57 378610 UTSW Mbd3 1.000 R4921 G1 225 N 10 80395576 R12S G T missense Het probably damaging 1.000 phenotype 04/15/2016
58 378588 UTSW Msr1 0.064 R4921 G1 225 N 8 39624251 E106G T C missense Het possibly damaging 0.719 phenotype 04/15/2016
59 378614 UTSW Myh4 0.230 R4921 G1 225 N 11 67254028 L1256Q T A missense Het probably damaging 0.998 phenotype 04/15/2016
60 378608 UTSW Mypn 0.297 R4921 G1 225 N 10 63147936 T511M G A missense Het possibly damaging 0.747 phenotype 04/15/2016
61 378556 UTSW Nub1 0.874 R4921 G1 225 N 5 24701469 N331I A T missense Het probably benign 0.382 phenotype 04/15/2016
62 378611 UTSW Nup107 0.967 R4921 G1 225 N 10 117770511 V440A A G missense Het possibly damaging 0.953 phenotype 04/15/2016
63 378626 UTSW Ofcc1 0.000 R4921 G1 225 N 13 40214517 F174L A G missense Het probably benign 0.099 phenotype 04/15/2016
64 378655 UTSW Olfr1497 0.215 R4921 G1 225 N 19 13795465 I49V T C missense Het probably benign 0.028 phenotype 04/15/2016
65 378581 UTSW Olfr597 0.065 R4921 G1 225 N 7 103320543 N44I A T missense Het probably damaging 1.000 phenotype 04/15/2016
66 378602 UTSW Olfr975 0.057 R4921 G1 225 N 9 39950225 V182G A C missense Het probably damaging 0.984 phenotype 04/15/2016
67 378629 UTSW Parp2 0.391 R4921 G1 225 N 14 50819268 L310I C A missense Het probably damaging 0.987 phenotype 04/15/2016
68 378633 UTSW Pcdh20 0.000 R4921 G1 225 N 14 88469726 V46A A G missense Het probably benign 0.015 phenotype 04/15/2016
69 378652 UTSW Pcdhgb6 0.133 R4921 G1 225 N 18 37743472 D411G A G missense Het probably damaging 0.999 phenotype 04/15/2016
70 378598 UTSW Pkd1l2 0.000 R4921 G1 134 N 8 117054885 E807G T C missense Het probably benign 0.027 phenotype 04/15/2016
71 378599 UTSW Pkd1l2 0.000 R4921 G1 225 N 8 117072549 N267K A T missense Het probably damaging 0.966 phenotype 04/15/2016
72 378557 UTSW Rell1 0.081 R4921 G1 225 N 5 63936033 M126I C A missense Het probably damaging 0.998 04/15/2016
73 378601 UTSW Robo4 0.223 R4921 G1 225 N 9 37402560 E36K G A missense Het probably benign 0.000 phenotype 04/15/2016
74 378594 UTSW Rpgrip1l 1.000 R4921 G1 225 N 8 91261009 S807G T C missense Het probably benign 0.049 phenotype 04/15/2016
75 378643 UTSW Rpl10a 0.924 R4921 G1 225 N 17 28330852 V169A T C missense Het probably benign 0.146 phenotype 04/15/2016
76 378637 UTSW Rubcn 0.931 R4921 G1 225 N 16 32847294 V166I C T missense Het probably damaging 1.000 phenotype 04/15/2016
77 378630 UTSW Sall2 0.000 R4921 G1 225 N 14 52315393 E113G T C missense Het possibly damaging 0.932 phenotype 04/15/2016
78 378575 UTSW Sars2 0.911 R4921 G1 100 N 7 28752438 S423P T C missense Het possibly damaging 0.812 phenotype 04/15/2016
79 378603 UTSW Scaper 0.710 R4921 G1 225 N 9 55892235 I182T A G missense Het probably benign 0.022 04/15/2016
80 378540 UTSW Selp 0.135 R4921 G1 225 N 1 164141397 D522G A G missense Het possibly damaging 0.933 phenotype 04/15/2016
81 378580 UTSW Sema4b 0.711 R4921 G1 81 N 7 80198756 I35N T A missense Het possibly damaging 0.769 phenotype 04/15/2016
82 378567 UTSW Sgce 0.451 R4921 G1 225 N 6 4694153 F268I A T missense Het probably damaging 1.000 phenotype 04/15/2016
83 378653 UTSW Slc14a2 0.000 R4921 G1 225 N 18 78192188 A258E G T missense Het probably damaging 0.969 phenotype 04/15/2016
84 378546 UTSW Slc17a9 0.000 R4921 G1 225 N 2 180735949 Y213H T C missense Het probably benign 0.002 phenotype 04/15/2016
85 378647 UTSW Slc22a7 0.091 R4921 G1 105 N 17 46436933 I233L T G missense Het probably benign 0.004 phenotype 04/15/2016
86 378607 UTSW Slc35f1 0.000 R4921 G1 215 N 10 53062602 Q210R A G missense Het probably damaging 0.988 phenotype 04/15/2016
87 378577 UTSW Slc6a21 0.057 R4921 G1 225 N 7 45288310 E350G A G missense Het possibly damaging 0.532 04/15/2016
88 378554 UTSW Spata21 0.112 R4921 G1 170 N 4 141112091 D639V A T missense Het probably damaging 0.999 04/15/2016
89 378651 UTSW Svil 0.186 R4921 G1 225 N 18 5108631 D1519G A G missense Het probably damaging 0.996 phenotype 04/15/2016
90 378636 UTSW Tbccd1 0.000 R4921 G1 225 N 16 22841899 T56A T C missense Het probably benign 0.016 04/15/2016
91 378638 UTSW Tigit 0.063 R4921 G1 225 N 16 43662017 I118N A T missense Het probably damaging 0.996 phenotype 04/15/2016
92 378628 UTSW Tlr11 0.000 R4921 G1 225 N 14 50362885 Q776L A T missense Het possibly damaging 0.483 04/15/2016
93 378568 UTSW Tspan12 0.124 R4921 G1 225 N 6 21835449 I9S A C missense Het possibly damaging 0.663 phenotype 04/15/2016
94 378551 UTSW Unc5c 1.000 R4921 G1 225 N 3 141788966 Y347N T A missense Het probably damaging 1.000 phenotype 04/15/2016
95 378619 UTSW Unk 0.791 R4921 G1 225 N 11 116054945 T481A A G missense Het probably benign 0.000 04/15/2016
96 378624 UTSW Vmn1r192 0.077 R4921 G1 225 N 13 22187480 V190G A C missense Het probably damaging 0.999 04/15/2016
97 378605 UTSW Vnn3 0.061 R4921 G1 225 N 10 23864575 M259L A T missense Het probably benign 0.006 04/15/2016
98 378566 UTSW Zan 0.074 R4921 G1 225 N 5 137408370 T C unclassified Het probably benign phenotype 04/15/2016
99 378657 UTSW Zdhhc6 0.000 R4921 G1 213 N 19 55313210 H113R T C missense Het probably damaging 0.959 04/15/2016
[records 1 to 99 of 99]