Incidental Mutations

94 incidental mutations are currently displayed, and affect 93 genes.
11 are Possibly Damaging.
33 are Probably Damaging.
34 are Probably Benign.
15 are Probably Null.
9 create premature stop codons.
5 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 94 of 94] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 385341 UTSW 9530053A07Rik 0.184 R4997 G1 225 N 7 28143924 S746A T G missense Het possibly damaging 0.774 05/10/2016
2 385374 UTSW A630023A22Rik 0.093 R4997 G1 225 N 14 34053666 M1L A T start codon destroyed Het probably benign 0.032 05/10/2016
3 385359 UTSW Abca7 0.000 R4997 G1 223 N 10 80007320 Q1210K C A missense Het possibly damaging 0.904 phenotype 05/10/2016
4 385378 UTSW Abcc4 0.000 R4997 G1 225 N 14 118516503 W1024* C T nonsense Het probably null phenotype 05/10/2016
5 385318 UTSW Accs 0.084 R4997 G1 225 N 2 93841883 Y213* A T nonsense Het probably null 05/10/2016
6 385370 UTSW Adam6a 0.070 R4997 G1 225 N 12 113545371 G455C G T missense Het probably damaging 1.000 05/10/2016
7 385361 UTSW Adcy1 0.000 R4997 G1 225 N 11 7161298 Y863S A C missense Het probably benign 0.250 phenotype 05/10/2016
8 385353 UTSW Adgrg1 0.171 R4997 G1 225 N 8 95009520 D434G A G missense Het probably damaging 1.000 phenotype 05/10/2016
9 385395 UTSW Afap1l1 0.102 R4997 G1 225 N 18 61751808 R202Q C T missense Het probably benign 0.000 05/10/2016
10 385363 UTSW Aldh3a1 0.000 R4997 G1 157 N 11 61212311 V27A T C missense Het probably benign 0.023 phenotype 05/10/2016
11 385336 UTSW Antxr2 0.132 R4997 G1 108 N 5 97977694 F235L A G missense Het probably benign 0.037 phenotype 05/10/2016
12 385367 UTSW Arhgap23 0.000 R4997 G1 225 N 11 97452020 V376E T A missense Het probably damaging 0.980 phenotype 05/10/2016
13 385368 UTSW Brca1 1.000 R4997 G1 225 N 11 101524333 S992A A C missense Het probably damaging 0.962 phenotype 05/10/2016
14 385316 UTSW Calcrl 1.000 R4997 G1 225 N 2 84351248 C185* A T nonsense Het probably null phenotype 05/10/2016
15 385320 UTSW Cep152 1.000 R4997 G1 225 N 2 125586351 T787A T C missense Het probably benign 0.003 phenotype 05/10/2016
16 385369 UTSW Coch 0.000 R4997 G1 225 N 12 51603181 T A splice site Het probably null phenotype 05/10/2016
17 385310 UTSW Col5a1 1.000 R4997 G1 183 N 2 28032782 Y287* T A nonsense Het probably null phenotype 05/10/2016
18 385355 UTSW Dis3l 0.330 R4997 G1 225 N 9 64311942 S569P A G missense Het possibly damaging 0.762 phenotype 05/10/2016
19 385328 UTSW Dnaic1 0.458 R4997 G1 225 N 4 41597919 I74V A G missense Het possibly damaging 0.800 phenotype 05/10/2016
20 385327 UTSW Dpy19l4 0.103 R4997 G1 225 N 4 11287493 V394A A G missense Het probably benign 0.006 05/10/2016
21 385323 UTSW Egfem1 0.000 R4997 G1 225 N 3 29153590 H122R A G missense Het probably benign 0.005 05/10/2016
22 385385 UTSW Endou 0.000 R4997 G1 225 N 15 97719577 L164P A G missense Het probably damaging 1.000 phenotype 05/10/2016
23 385335 UTSW Epgn 0.000 R4997 G1 225 N 5 91032239 E80G A G missense Het possibly damaging 0.583 phenotype 05/10/2016
24 385375 UTSW Fitm1 0.281 R4997 G1 225 N 14 55576907 S287P T C missense Het probably benign 0.000 phenotype 05/10/2016
25 385339 UTSW Foxm1 1.000 R4997 G1 225 N 6 128365768 N22D A G missense Het probably benign 0.064 phenotype 05/10/2016
26 512173 UTSW Gm5136 0.151 R4997 G1 225 N 10 108699788 I102T A G missense Het probably benign 0.004 04/10/2018
27 385380 UTSW Gsdmc 0.053 R4997 G1 225 N 15 63776780 M426K A T missense Het probably damaging 0.997 05/10/2016
28 385311 UTSW Hmcn2 0.000 R4997 G1 225 N 2 31401708 V2418D T A missense Het probably damaging 0.995 05/10/2016
29 385347 UTSW Hs3st2 0.000 R4997 G1 225 N 7 121500456 L175Q T A missense Het possibly damaging 0.946 phenotype 05/10/2016
30 385304 UTSW Il1r2 0.000 R4997 G1 225 N 1 40121046 T C critical splice donor site 2 bp Het probably null phenotype 05/10/2016
31 385352 UTSW Il27ra 0.066 R4997 G1 225 N 8 84039527 Y209* A T nonsense Het probably null phenotype 05/10/2016
32 385350 UTSW Inpp5a 1.000 R4997 G1 142 N 7 139400738 S31C A T missense Het probably benign 0.069 phenotype 05/10/2016
33 385329 UTSW Invs 0.776 R4997 G1 225 N 4 48396332 D335G A G missense Het probably damaging 0.980 phenotype 05/10/2016
34 385333 UTSW Isg15 0.000 R4997 G1 225 N 4 156199697 E125K C T missense Het possibly damaging 0.576 phenotype 05/10/2016
35 385343 UTSW Klk14 0.000 R4997 G1 225 N 7 43692077 C51Y G A missense Het probably damaging 1.000 0.793 phenotype 05/10/2016
36 385357 UTSW Lama4 1.000 R4997 G1 225 N 10 39092266 T1468K C A missense Het probably damaging 0.990 phenotype 05/10/2016
37 385325 UTSW Lce1a2 R4997 G1 225 N 3 92669088 S56P A G missense Het unknown 05/10/2016
38 385362 UTSW Llgl1 1.000 R4997 G1 225 N 11 60709568 P581L C T missense Het probably benign 0.000 0.062 phenotype 05/10/2016
39 486813 UTSW Lmf1 1.000 R4997 G1 225 N 17 25588676 W164* G A nonsense Het probably null phenotype 08/17/2017
40 385392 UTSW Mad2l1bp 0.909 R4997 G1 225 N 17 46152878 C73* G T nonsense Het probably null phenotype 05/10/2016
41 385309 UTSW Mpzl1 0.000 R4997 G1 225 N 1 165601781 V230G A C missense Het probably damaging 0.983 phenotype 05/10/2016
42 385313 UTSW Myo3b 0.000 R4997 G1 225 N 2 70258083 T869A A G missense Het possibly damaging 0.486 phenotype 05/10/2016
43 385338 UTSW Ncor2 1.000 R4997 G1 211 N 5 125034010 H1316R T C missense Het probably damaging 0.990 phenotype 05/10/2016
44 385366 UTSW Nlrp1b 0.092 R4997 G1 225 N 11 71218334 I114F T A missense Het probably damaging 0.999 phenotype 05/10/2016
45 385334 UTSW Nsun7 0.000 R4997 G1 225 N 5 66295839 I632M A G missense Het probably benign 0.016 phenotype 05/10/2016
46 385389 UTSW Nubp1 1.000 R4997 G1 225 N 16 10421321 I234T T C missense Het probably benign 0.003 phenotype 05/10/2016
47 385345 UTSW Olfml1 0.086 R4997 G1 225 N 7 107571206 D100G A G missense Het probably damaging 1.000 05/10/2016
48 512174 UTSW Olfr22-ps1 0.242 R4997 G1 225 N 11 73954786 L32Q T A missense Het probably damaging 1.000 04/10/2018
49 385346 UTSW Olfr498 0.071 R4997 G1 225 N 7 108465494 Q57K C A missense Het probably benign 0.013 phenotype 05/10/2016
50 512172 UTSW Olfr839-ps1 0.232 R4997 G1 93 N 9 19175331 L115Q A T missense Het probably damaging 1.000 04/10/2018
51 385379 UTSW Osmr 0.053 R4997 G1 225 N 15 6815639 P882Q G T missense Het probably benign 0.254 phenotype 05/10/2016
52 512171 UTSW Peg10 1.000 R4997 G1 132 N 6 4756457 TCAGGATCC TCAGGATCCCCAGCAGGATCC small insertion Het probably benign phenotype 04/10/2018
53 385306 UTSW Per2 0.216 R4997 G1 225 N 1 91450783 T15S T A missense Het probably benign 0.017 phenotype 05/10/2016
54 385396 UTSW Piezo2 1.000 R4997 G1 225 N 18 63083113 Y1184H A G missense Het probably damaging 1.000 phenotype 05/10/2016
55 385307 UTSW Pik3c2b 0.303 R4997 G1 225 N 1 133105081 A1560V C T missense Het probably damaging 1.000 phenotype 05/10/2016
56 385330 UTSW Pik3cd 0.956 R4997 G1 225 N 4 149658984 L256R A C missense Het probably damaging 1.000 phenotype 05/10/2016
57 385388 UTSW Ppl 0.000 R4997 G1 225 N 16 5089371 R1020L C A missense Het probably damaging 1.000 phenotype 05/10/2016
58 385391 UTSW Ppp1r10 1.000 R4997 G1 203 N 17 35924084 N60S A G missense Het probably damaging 1.000 phenotype 05/10/2016
59 385340 UTSW Prkcg 0.000 R4997 G1 225 N 7 3322581 T C critical splice donor site 2 bp Het probably null phenotype 05/10/2016
60 385324 UTSW Prkci 1.000 R4997 G1 225 N 3 31031226 T C critical splice donor site 2 bp Het probably null phenotype 05/10/2016
61 385312 UTSW Prrc2b 1.000 R4997 G1 225 N 2 32222311 Y1929C A G missense Het probably damaging 1.000 05/10/2016
62 385326 UTSW Prss12 0.117 R4997 G1 139 N 3 123447208 V17A T C missense Het probably benign 0.015 phenotype 05/10/2016
63 385354 UTSW Qtrt1 0.439 R4997 G1 225 N 9 21417358 N206S A G missense Het probably benign 0.001 phenotype 05/10/2016
64 385356 UTSW Rad54l2 1.000 R4997 G1 225 N 9 106722909 S50A A C missense Het possibly damaging 0.705 phenotype 05/10/2016
65 385319 UTSW Rhov 0.192 R4997 G1 225 N 2 119270468 R96H C T missense Het probably damaging 1.000 05/10/2016
66 385337 UTSW Rph3a 0.000 R4997 G1 225 N 5 120963843 V110E A T missense Het probably damaging 0.960 phenotype 05/10/2016
67 385305 UTSW Rufy4 0.187 R4997 G1 225 N 1 74147663 C537R T C missense Het probably damaging 0.988 0.860 05/10/2016
68 385371 UTSW Ryr2 1.000 R4997 G1 225 N 13 11595306 N646K A T missense Het probably benign 0.090 phenotype 05/10/2016
69 385387 UTSW Scn8a 0.872 R4997 G1 225 N 15 100957054 T141A A G missense Het probably damaging 0.998 phenotype 05/10/2016
70 385317 UTSW Serping1 0.104 R4997 G1 190 N 2 84770285 R238G T C missense Het possibly damaging 0.740 phenotype 05/10/2016
71 385383 UTSW Shank3 0.314 R4997 G1 225 N 15 89549698 W1474R T A missense Het probably damaging 1.000 phenotype 05/10/2016
72 385397 UTSW Slc16a12 0.069 R4997 G1 225 N 19 34674958 M263L T A missense Het probably benign 0.004 phenotype 05/10/2016
73 385376 UTSW Spata13 0.000 R4997 G1 225 N 14 60709459 V652A T C missense Het probably damaging 0.998 0.224 phenotype 05/10/2016
74 385373 UTSW Spata31 0.280 R4997 G1 179 N 13 64919723 M66I G A missense Het probably benign 0.003 05/10/2016
75 385365 UTSW Spem2 0.057 R4997 G1 225 N 11 69817732 I136V T C missense Het probably benign 0.061 05/10/2016
76 385342 UTSW Supt5 1.000 R4997 G1 225 N 7 28316037 H925R T C missense Het probably benign 0.046 05/10/2016
77 385372 UTSW Syk 1.000 R4997 G1 225 N 13 52612448 K190* A T nonsense Het probably null phenotype 05/10/2016
78 385351 UTSW Thsd1 0.000 R4997 G1 225 N 8 22243324 V129D T A missense Het probably damaging 0.979 phenotype 05/10/2016
79 385308 UTSW Tiprl 1.000 R4997 G1 225 N 1 165220190 V174A A G missense Het possibly damaging 0.531 phenotype 05/10/2016
80 385360 UTSW Tmed4 0.146 R4997 G1 225 N 11 6274500 T A critical splice acceptor site Het probably null 05/10/2016
81 385377 UTSW Tnfrsf19 0.000 R4997 G1 224 N 14 60971209 T288A T C missense Het probably benign 0.000 phenotype 05/10/2016
82 385332 UTSW Tnfrsf25 0.000 R4997 G1 225 N 4 152117696 T C critical splice donor site 2 bp Het probably null phenotype 05/10/2016
83 385322 UTSW Tpd52 0.131 R4997 G1 225 N 3 8934996 L121S A G missense Het probably damaging 0.999 05/10/2016
84 385344 UTSW Trim30a 0.087 R4997 G1 211 N 7 104411620 K316N T A missense Het probably benign 0.210 phenotype 05/10/2016
85 385390 UTSW Ttc3 0.669 R4997 G1 225 N 16 94452982 D1221E T G missense Het probably damaging 0.999 05/10/2016
86 385314 UTSW Ttn 1.000 R4997 G1 225 N 2 76884059 C T intron Het probably benign phenotype 05/10/2016
87 385315 UTSW Ttn 1.000 R4997 G1 225 N 2 76946271 I1514V T C missense Het probably benign 0.001 phenotype 05/10/2016
88 385364 UTSW Ulk2 0.380 R4997 G1 225 N 11 61799156 T671A T C missense Het probably benign 0.001 phenotype 05/10/2016
89 385358 UTSW Wasf1 0.560 R4997 G1 225 N 10 40934604 P281S C T missense Het probably damaging 0.960 phenotype 05/10/2016
90 385386 UTSW Wnt10b 0.000 R4997 G1 225 N 15 98774203 R211L C A missense Het probably damaging 0.993 phenotype 05/10/2016
91 385382 UTSW Xpnpep3 0.000 R4997 G1 225 N 15 81448376 C371* T A nonsense Het probably null 05/10/2016
92 385381 UTSW Zfp41 0.251 R4997 G1 225 N 15 75618768 C T unclassified Het probably benign 05/10/2016
93 385348 UTSW Zfp553 1.000 R4997 G1 225 N 7 127235511 N79K T A missense Het probably benign 0.150 phenotype 05/10/2016
94 385321 UTSW Zmynd8 1.000 R4997 G1 225 N 2 165792816 D1096E G T missense Het probably benign 0.006 phenotype 05/10/2016
[records 1 to 94 of 94]