Incidental Mutations

39 incidental mutations are currently displayed, and affect 39 genes.
5 are Possibly Damaging.
14 are Probably Damaging.
14 are Probably Benign.
6 are Probably Null.
2 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 39 of 39] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 393230 UTSW Adgrg7 0.000 R5041 G1 225 Y 16 56730348 F667S A G missense Het probably benign 0.213 0.090 phenotype 06/15/2016
2 393204 UTSW Akna 0.153 R5041 G1 225 Y 4 63387144 Y462H A G missense Het possibly damaging 0.670 0.179 phenotype 06/15/2016
3 393228 UTSW Anxa11 0.143 R5041 G1 225 Y 14 25874764 E278* G T nonsense Het probably null 0.976 phenotype 06/15/2016
4 393212 UTSW Ap3s2 0.000 R5041 G1 163 Y 7 79920519 Y20C T C missense Het probably benign 0.069 0.954 06/15/2016
5 393227 UTSW Atxn7 0.000 R5041 G1 225 Y 14 14096317 T C critical splice donor site 2 bp Het probably null 0.950 phenotype 06/15/2016
6 393217 UTSW AW551984 0.059 R5041 G1 189 Y 9 39600598 Y39C T C missense Het probably damaging 1.000 0.848 06/15/2016
7 393224 UTSW Becn1 1.000 R5041 G1 225 Y 11 101288836 S442T A T missense Het probably benign 0.300 0.383 phenotype 06/15/2016
8 393209 UTSW Bhlhe40 0.000 R5041 G1 225 Y 6 108662585 T108I C T missense Het probably damaging 0.988 0.226 phenotype 06/15/2016
9 393197 UTSW Cnst 0.231 R5041 G1 225 Y 1 179605028 D252G A G missense Het probably damaging 0.994 0.133 phenotype 06/15/2016
10 393200 UTSW Cpxm1 0.439 R5041 G1 225 Y 2 130394070 S391P A G missense Het probably damaging 1.000 0.592 phenotype 06/15/2016
11 393208 UTSW Ctnna2 0.932 R5041 G1 225 Y 6 76915763 N814Y T A missense Het probably damaging 0.999 0.657 phenotype 06/15/2016
12 393232 UTSW Ddx3y 0.029 R5041 G1 222 Y Y 1266611 Y282F T A missense Het probably benign 0.051 0.090 phenotype 06/15/2016
13 393222 UTSW Ddx56 0.966 R5041 G1 225 Y 11 6264178 V357A A G missense Het probably damaging 1.000 0.733 phenotype 06/15/2016
14 393203 UTSW Frmpd1 0.000 R5041 G1 225 Y 4 45278878 C534W T G missense Het probably damaging 0.999 0.647 06/15/2016
15 393207 UTSW Gimap8 0.000 R5041 G1 225 Y 6 48659163 N621D A G missense Het probably damaging 1.000 0.262 phenotype 06/15/2016
16 393206 UTSW Gm13023 0.105 R5041 G1 225 Y 4 143793690 V4A T C missense Het probably benign 0.007 0.090 06/15/2016
17 393221 UTSW Herc1 0.000 R5041 G1 225 Y 9 66429045 I1624N T A missense Het possibly damaging 0.863 0.147 phenotype 06/15/2016
18 393231 UTSW Htr7 0.000 R5041 G1 175 Y 19 36057067 W63G A C missense Het probably benign 0.104 0.078 phenotype 06/15/2016
19 452800 UTSW Ly6g6c 0.118 R5041 G1 225 Y 17 35065452 T A critical splice donor site 2 bp Het probably null 0.976 phenotype 01/06/2017
20 393205 UTSW Macf1 1.000 R5041 G1 225 Y 4 123397046 T C intron 48 bp Het probably null 0.976 phenotype 06/15/2016
21 393218 UTSW Mfrp 0.193 R5041 G1 225 Y 9 44102278 D62G A G missense Het probably damaging 1.000 0.327 phenotype 06/15/2016
22 393220 UTSW Ncam1 0.902 R5041 G1 225 Y 9 49566785 Y173C T C missense Het probably damaging 1.000 0.223 phenotype 06/15/2016
23 393215 UTSW Nwd1 0.204 R5041 G1 225 Y 8 72705055 V1185A T C missense Het possibly damaging 0.896 0.152 phenotype 06/15/2016
24 393199 UTSW Olfr1218 0.056 R5041 G1 225 Y 2 89054921 C168* A T nonsense Het probably null 0.967 phenotype 06/15/2016
25 452799 UTSW Olfr573-ps1 0.063 R5041 G1 225 Y 7 102942578 T C unclassified Het probably null 0.976 01/06/2017
26 393216 UTSW Papd5 0.941 R5041 G1 217 Y 8 88255250 CCCAACAACGCCAACAA CCCAACAA small deletion Het probably benign 0.090 06/15/2016
27 393213 UTSW Pcf11 0.963 R5041 G1 225 Y 7 92658405 P852S G A missense Het probably benign 0.003 0.059 phenotype 06/15/2016
28 393201 UTSW Ralgapa2 0.224 R5041 G1 225 Y 2 146485151 I63V T C missense Het probably benign 0.003 0.058 phenotype 06/15/2016
29 393214 UTSW Rsf1 1.000 R5041 G1 200 N 7 97579925 GCGGCGGCG GCGGCGGCGTCGGCGGCG unclassified Het probably benign phenotype 06/15/2016
30 393229 UTSW Rubcnl 0.124 R5041 G1 225 Y 14 75050132 F619L T C missense Het probably damaging 0.999 0.237 06/15/2016
31 393202 UTSW Sec24d 1.000 R5041 G1 186 Y 3 123294231 Q247L A T missense Het probably damaging 0.959 0.102 phenotype 06/15/2016
32 393223 UTSW Spns3 0.000 R5041 G1 225 Y 11 72536547 Q306K G T missense Het possibly damaging 0.462 0.179 06/15/2016
33 393225 UTSW Sstr1 1.000 R5041 G1 225 Y 12 58213155 V188A T C missense Het possibly damaging 0.945 0.241 phenotype 06/15/2016
34 393211 UTSW Supt5 1.000 R5041 G1 225 Y 7 28315380 L1024Q A T missense Het probably damaging 1.000 0.671 06/15/2016
35 452798 UTSW Thegl 0.067 R5041 G1 225 Y 5 77056081 T319A A G missense Het probably benign 0.051 0.090 01/06/2017
36 452797 UTSW Unc13b 0.712 R5041 G1 225 Y 4 43237836 H3452Q T A missense Het probably benign 0.411 0.102 phenotype 01/06/2017
37 393219 UTSW Usp28 0.000 R5041 G1 225 Y 9 49037773 Q864R A G missense Het probably benign 0.000 0.058 phenotype 06/15/2016
38 393210 UTSW Vmn2r43 0.096 R5041 G1 172 N 7 8244807 T786A T C missense Het probably damaging 0.999 06/15/2016
39 393226 UTSW Yy1 1.000 R5041 G1 113 Y 12 108793631 TCACCACCACCACCACCACCACCACCACC TCACCACCACCACCACCACCACCACCACCACC small insertion Het probably benign phenotype 06/15/2016
[records 1 to 39 of 39]