Incidental Mutations

46 incidental mutations are currently displayed, and affect 46 genes.
6 are Possibly Damaging.
22 are Probably Damaging.
14 are Probably Benign.
4 are Probably Null.
2 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 46 of 46] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 403493 UTSW 2700097O09Rik 0.208 R5216 G1 225 N 12 55061162 V84D A T missense Het probably damaging 0.998 07/22/2016
2 403470 UTSW Abcb1b 0.326 R5216 G1 225 N 5 8813705 V220A T C missense Het probably benign 0.037 phenotype 07/22/2016
3 403492 UTSW Actg1 1.000 R5216 G1 225 N 11 120347754 M82K A T missense Het probably damaging 0.984 phenotype 07/22/2016
4 403485 UTSW Ahi1 0.834 R5216 G1 225 N 10 20960076 S103P T C missense Het probably benign 0.001 phenotype 07/22/2016
5 403469 UTSW Aldh1b1 0.000 R5216 G1 225 N 4 45803652 G397C G T missense Het probably damaging 0.996 phenotype 07/22/2016
6 403495 UTSW Arhgef3 0.162 R5216 G1 225 N 14 27401842 T507A A G missense Het probably benign 0.001 phenotype 07/22/2016
7 403477 UTSW Atg7 1.000 R5216 G1 225 N 6 114724949 D682G A G missense Het probably damaging 0.965 phenotype 07/22/2016
8 403501 UTSW Atp13a3 0.496 R5216 G1 225 N 16 30340284 I783T A G missense Het probably damaging 0.999 phenotype 07/22/2016
9 403464 UTSW Atp9a 0.000 R5216 G1 219 N 2 168674888 I362V T C missense Het probably benign 0.382 07/22/2016
10 403494 UTSW BC067074 0.207 R5216 G1 225 N 13 113342413 C1497Y G A missense Het probably benign 0.197 07/22/2016
11 403503 UTSW Birc6 1.000 R5216 G1 225 N 17 74613470 I168K T A missense Het probably damaging 0.999 phenotype 07/22/2016
12 403474 UTSW Brca2 1.000 R5216 G1 225 N 5 150542980 Y2070N T A missense Het probably damaging 0.988 phenotype 07/22/2016
13 403488 UTSW Cabp7 0.224 R5216 G1 138 N 11 4738873 I199T A G missense Het probably damaging 1.000 07/22/2016
14 403490 UTSW Cacng5 0.066 R5216 G1 225 N 11 107877489 F231L A G missense Het possibly damaging 0.549 phenotype 07/22/2016
15 403468 UTSW Cngb3 0.100 R5216 G1 225 N 4 19415729 V413D T A missense Het possibly damaging 0.931 phenotype 07/22/2016
16 403467 UTSW Col24a1 0.000 R5216 G1 225 N 3 145315310 E481K G A missense Het possibly damaging 0.854 phenotype 07/22/2016
17 403482 UTSW Ctr9 1.000 R5216 G1 225 N 7 111045458 I560N T A missense Het possibly damaging 0.678 phenotype 07/22/2016
18 499953 UTSW Dip2b 0.606 R5216 G1 225 N 15 100211986 R1451C C T missense Het probably damaging 0.995 0.257 phenotype 11/30/2017
19 403483 UTSW Fat3 0.487 R5216 G1 225 N 9 16377537 D230G T C missense Het probably damaging 1.000 phenotype 07/22/2016
20 499952 UTSW Gramd4 0.000 R5216 G1 225 N 15 86134785 G A critical splice acceptor site Het probably null phenotype 11/30/2017
21 403462 UTSW Grb14 0.219 R5216 G1 225 N 2 64917309 V369I C T missense Het probably benign 0.002 phenotype 07/22/2016
22 403463 UTSW Hoxd1 0.298 R5216 G1 225 N 2 74764351 N317Y A T missense Het probably damaging 0.972 phenotype 07/22/2016
23 403466 UTSW Kcnc4 0.092 R5216 G1 225 N 3 107439441 S623P A G missense Het probably benign 0.000 phenotype 07/22/2016
24 403461 UTSW Klhl20 0.236 R5216 G1 225 N 1 161093679 A G critical splice donor site 2 bp Het probably null phenotype 07/22/2016
25 403460 UTSW Lamc1 1.000 R5216 G1 225 N 1 153227696 V1375L C A missense Het probably damaging 0.997 0.103 phenotype 07/22/2016
26 403502 UTSW Lpin2 0.412 R5216 G1 225 N 17 71242760 S640L C T missense Het probably damaging 0.997 phenotype 07/22/2016
27 403479 UTSW Ltbp4 1.000 R5216 G1 217 N 7 27327311 AATTCAGGCCAAGGCTGGGATTCAGGCCGAGGCCGGGATTCAGGCCTAGGCTGGGATTCAGGC AATTCAGGCCTAGGCTGGGATTCAGGC small deletion Het probably benign 0.090 phenotype 07/22/2016
28 403476 UTSW Mgll 0.140 R5216 G1 225 N 6 88766329 C110* T A nonsense Het probably null phenotype 07/22/2016
29 403496 UTSW Mmp14 0.922 R5216 G1 225 N 14 54437663 N251D A G missense Het possibly damaging 0.823 phenotype 07/22/2016
30 403489 UTSW Olfr393 0.121 R5216 G1 225 N 11 73847436 S230T A T missense Het probably damaging 0.969 phenotype 07/22/2016
31 403481 UTSW Olfr552 0.120 R5216 G1 225 N 7 102604821 T156A A G missense Het probably benign 0.004 phenotype 07/22/2016
32 403484 UTSW Olfr857 0.084 R5216 G1 225 N 9 19713289 V154E T A missense Het probably benign 0.070 phenotype 07/22/2016
33 403486 UTSW Pfkl 1.000 R5216 G1 197 N 10 78009670 D5A T G missense Het probably damaging 0.987 phenotype 07/22/2016
34 403504 UTSW Pik3c3 1.000 R5216 G1 170 N 18 30272976 Y9C A G missense Het probably damaging 1.000 phenotype 07/22/2016
35 403497 UTSW Pkhd1l1 0.000 R5216 G1 225 N 15 44495647 Y417* T A nonsense Het probably null 07/22/2016
36 403491 UTSW Rptor 1.000 R5216 G1 225 N 11 119843713 G514D G A missense Het probably damaging 0.977 0.727 phenotype 07/22/2016
37 403459 UTSW Sulf1 0.495 R5216 G1 225 N 1 12796874 M94K T A missense Het probably benign 0.275 phenotype 07/22/2016
38 499950 UTSW Synrg 1.000 R5216 G1 225 N 11 83982196 T157A A G missense Het probably damaging 0.992 phenotype 11/30/2017
39 403487 UTSW Syt1 1.000 R5216 G1 225 N 10 108642257 N102S T C missense Het probably benign 0.003 phenotype 07/22/2016
40 403471 UTSW Tnip2 0.290 R5216 G1 225 N 5 34503805 R101H C T missense Het probably damaging 0.990 phenotype 07/22/2016
41 403500 UTSW Trmt2a 0.000 R5216 G1 225 N 16 18252184 D421G A G missense Het probably benign 0.221 phenotype 07/22/2016
42 403478 UTSW Vmn1r67 0.074 R5216 G1 225 N 7 10447163 D57G A G missense Het probably benign 0.005 07/22/2016
43 403465 UTSW Wnt2b 0.000 R5216 G1 225 N 3 104961345 L43P A G missense Het possibly damaging 0.956 phenotype 07/22/2016
44 403472 UTSW Zfp113 0.127 R5216 G1 225 N 5 138150715 D56N C T missense Het probably damaging 0.999 07/22/2016
45 499951 UTSW Zfp184 0.119 R5216 G1 225 N 13 21950236 L69F C T missense Het probably damaging 0.998 phenotype 11/30/2017
46 403475 UTSW Zyx 0.000 R5216 G1 225 N 6 42356532 V464A T C missense Het probably damaging 0.957 phenotype 07/22/2016
[records 1 to 46 of 46]