Incidental Mutations

46 incidental mutations are currently displayed, and affect 46 genes.
8 are Possibly Damaging.
15 are Probably Damaging.
15 are Probably Benign.
6 are Probably Null.
3 create premature stop codons.
0 are critical splice junction mutations.
Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 46 of 46] per page Full List
 
 ID question?
 Source question?
 Gene question?
 E-score question?
  		Stock # question?
 Gen question?
 Quality
- 		Vld question?
 Strain question?
 Chr question?
 Position question?
 		 Mutation question?
 Ref
 Var
 Type question?
 Exon Dist question?
  		Zygosity question?
 Predicted Effect question?
 PPH Score question?
- 		Meta Score question?
  		MGI Phenotype question?
 Posted question?
 
1 403987 UTSW Abi1 0.807 R5277 G1 225 Y 2 22994648 T54A T C missense Het probably damaging 0.998 0.158 phenotype 07/22/2016
2 404028 UTSW Ablim1 0.429 R5277 G1 225 Y 19 57155261 R89G T C missense Het probably damaging 1.000 0.647 phenotype 07/22/2016
3 404007 UTSW Bco1 0.137 R5277 G1 198 Y 8 117117389 T A splice site Het probably null 0.976 phenotype 07/22/2016
4 404016 UTSW Bhmt 0.000 R5277 G1 225 Y 13 93624885 M185K A T missense Het possibly damaging 0.640 0.535 phenotype 07/22/2016
5 403990 UTSW Camk2d 0.221 R5277 G1 225 Y 3 126684741 T C intron Het probably benign 0.090 phenotype 07/22/2016
6 404006 UTSW Cmtm1 0.399 R5277 G1 121 Y 8 104309470 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT small deletion Het probably benign 0.090 07/22/2016
7 403985 UTSW Dcaf6 0.000 R5277 G1 225 Y 1 165424346 S70P A G missense Het probably benign 0.090 0.867 07/22/2016
8 404027 UTSW Dclre1a 0.000 R5277 G1 225 Y 19 56544732 V477I C T missense Het possibly damaging 0.783 0.064 phenotype 07/22/2016
9 403995 UTSW Dnah10 0.000 R5277 G1 225 Y 5 124828137 P4021L C T missense Het probably damaging 0.998 0.406 phenotype 07/22/2016
10 403986 UTSW Dusp10 0.680 R5277 G1 225 Y 1 184037007 N57D A G missense Het possibly damaging 0.944 0.062 phenotype 07/22/2016
11 404024 UTSW Fam13b 0.295 R5277 G1 225 Y 18 34462190 R374C G A missense Het probably benign 0.000 0.090 07/22/2016
12 403991 UTSW Fyb2 0.063 R5277 G1 225 Y 4 105015679 D686N G A missense Het probably damaging 1.000 0.149 07/22/2016
13 404004 UTSW Glra3 0.000 R5277 G1 225 Y 8 55991207 M67I G A missense Het possibly damaging 0.793 0.124 phenotype 07/22/2016
14 403989 UTSW Gm14325 0.268 R5277 G1 146 N 2 177832984 H102Y G A missense Het possibly damaging 0.916 07/22/2016
15 404003 UTSW Gm6180 0.363 R5277 G1 225 Y 8 42247140 A G exon Het noncoding transcript 0.089 07/22/2016
16 404012 UTSW Grin2c 0.303 R5277 G1 225 Y 11 115253813 V629A A G missense Het probably damaging 1.000 0.202 phenotype 07/22/2016
17 404014 UTSW Kif4-ps 0.154 R5277 G1 225 Y 12 101145927 A T unclassified Het noncoding transcript 0.133 07/22/2016
18 403988 UTSW Mc3r 0.130 R5277 G1 225 Y 2 172249787 F310L T C missense Het probably damaging 0.999 0.106 phenotype 07/22/2016
19 404011 UTSW Myh4 0.285 R5277 G1 225 Y 11 67252354 D1036G A G missense Het probably damaging 0.998 0.328 phenotype 07/22/2016
20 404017 UTSW Myh6 1.000 R5277 G1 225 Y 14 54956562 I790T A G missense Het probably benign 0.012 0.090 phenotype 07/22/2016
21 404010 UTSW Myo15 0.000 R5277 G1 225 Y 11 60477114 Y233* C A nonsense Het probably null 0.976 phenotype 07/22/2016
22 403983 UTSW Nckap5 0.000 R5277 G1 225 Y 1 126026540 C758* A T nonsense Het probably null 0.976 07/22/2016
23 404008 UTSW Neurog3 1.000 R5277 G1 225 Y 10 62133853 Y36N T A missense Het probably damaging 1.000 0.970 phenotype 07/22/2016
24 403998 UTSW Nlrp4e 0.000 R5277 G1 225 Y 7 23321438 L450P T C missense Het probably benign 0.017 0.211 07/22/2016
25 404002 UTSW Olfr607 0.144 R5277 G1 225 Y 7 103460941 L84H A T missense Het probably damaging 0.964 0.647 phenotype 07/22/2016
26 403999 UTSW Otog 0.789 R5277 G1 225 Y 7 46246621 E170G A G missense Het possibly damaging 0.889 0.242 phenotype 07/22/2016
27 404025 UTSW Ppp2r2b 0.000 R5277 G1 225 Y 18 42741142 T41K G T missense Het probably damaging 1.000 0.857 phenotype 07/22/2016
28 478302 UTSW Prmt5 1.000 R5277 G1 225 Y 14 54509942 D459E A T missense Het probably benign 0.018 0.079 phenotype 06/21/2017
29 404009 UTSW Ric8b 1.000 R5277 G1 225 Y 10 84947652 V125M G A missense Het probably damaging 0.993 0.855 07/22/2016
30 404013 UTSW Rptor 1.000 R5277 G1 225 Y 11 119822956 S4G A G missense Het probably damaging 0.999 0.150 phenotype 07/22/2016
31 404015 UTSW Rslcan18 0.122 R5277 G1 225 Y 13 67098434 E371D T G missense Het probably benign 0.026 0.102 07/22/2016
32 404021 UTSW Scaf11 0.000 R5277 G1 225 Y 15 96419226 F819Y A T missense Het probably damaging 1.000 0.072 07/22/2016
33 404026 UTSW Sema6a 0.000 R5277 G1 225 Y 18 47276544 A T intron Het probably benign 0.090 phenotype 07/22/2016
34 404022 UTSW Snx29 0.000 R5277 G1 225 Y 16 11399824 T163I C T missense Het possibly damaging 0.819 0.093 07/22/2016
35 403982 UTSW Sphkap 0.084 R5277 G1 225 Y 1 83276164 N1288S T C missense Het probably benign 0.037 0.074 07/22/2016
36 403994 UTSW Tmbim7 0.119 R5277 G1 225 Y 5 3673192 G A splice site 5 bp Het probably null 0.976 07/22/2016
37 478301 UTSW Tmem63c 0.076 R5277 G1 225 Y 12 87057757 T A splice site 87 bp Het probably null 0.976 06/21/2017
38 403992 UTSW Tmem69 0.059 R5277 G1 225 Y 4 116553261 F171L A G missense Het probably benign 0.150 0.112 07/22/2016
39 403993 UTSW Urod 1.000 R5277 G1 225 Y 4 116990285 A T unclassified Het probably benign phenotype 07/22/2016
40 478300 UTSW Vmn1r37 0.115 R5277 G1 37 Y 6 66731476 I29L A T missense Het probably benign 0.026 0.090 06/21/2017
41 404023 UTSW Vmn2r102 0.000 R5277 G1 225 Y 17 19694131 T653A A G missense Het possibly damaging 0.485 0.179 07/22/2016
42 404000 UTSW Vmn2r75 0.071 R5277 G1 225 Y 7 86166292 S121R A C missense Het probably benign 0.000 0.090 07/22/2016
43 403996 UTSW Vwde 0.212 R5277 G1 225 Y 6 13186996 T831A T C missense Het probably benign 0.032 0.090 07/22/2016
44 404018 UTSW Wdr70 0.967 R5277 G1 225 Y 15 7976984 W362* C T nonsense Het probably null 0.976 07/22/2016
45 404019 UTSW Zfat 1.000 R5277 G1 225 Y 15 68165909 C906R A G missense Het probably damaging 1.000 0.967 phenotype 07/22/2016
46 404020 UTSW Zfp7 0.000 R5277 G1 225 N 15 76881203 V32A T C missense Het probably damaging 1.000 07/22/2016
[records 1 to 46 of 46]