Incidental Mutations

54 incidental mutations are currently displayed, and affect 54 genes.
8 are Possibly Damaging.
21 are Probably Damaging.
15 are Probably Benign.
7 are Probably Null.
3 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 54 of 54] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 429768 UTSW Acox2 0.125 R5397 G1 225 N 14 8243803 T518A T C missense Het probably benign 0.021 phenotype 09/06/2016
2 429772 UTSW Acvr1b 1.000 R5397 G1 225 N 15 101198964 V254D T A missense Het probably damaging 0.990 phenotype 09/06/2016
3 429732 UTSW Adar 1.000 R5397 G1 225 N 3 89735319 I169T T C missense Het probably benign 0.000 phenotype 09/06/2016
4 429775 UTSW Afg3l2 1.000 R5397 G1 225 N 18 67421259 L458M G T missense Het probably damaging 1.000 0.387 phenotype 09/06/2016
5 429744 UTSW Arap1 0.000 R5397 G1 225 N 7 101384912 Q187L A T missense Het possibly damaging 0.951 phenotype 09/06/2016
6 429759 UTSW Atad5 1.000 R5397 G1 225 N 11 80111493 M1037K T A missense Het probably damaging 0.999 phenotype 09/06/2016
7 429753 UTSW Bsg 0.921 R5397 G1 225 N 10 79708795 W56R T A missense Het probably damaging 1.000 phenotype 09/06/2016
8 429770 UTSW C1qtnf3 0.000 R5397 G1 225 N 15 10978541 T276A A G missense Het probably damaging 0.989 phenotype 09/06/2016
9 429725 UTSW Capn2 1.000 R5397 G1 225 N 1 182470706 C665R A G missense Het probably damaging 1.000 phenotype 09/06/2016
10 429767 UTSW Cast 0.000 R5397 G1 225 N 13 74720937 S248P A G missense Het possibly damaging 0.827 phenotype 09/06/2016
11 429758 UTSW Cd68 0.172 R5397 G1 225 N 11 69665658 V108I C T missense Het probably benign 0.003 phenotype 09/06/2016
12 429771 UTSW Cyp2d11 0.143 R5397 G1 225 N 15 82392078 W131R A T missense Het probably damaging 1.000 09/06/2016
13 429762 UTSW Dhx58 0.165 R5397 G1 225 N 11 100703920 V50A A G missense Het probably damaging 0.998 phenotype 09/06/2016
14 429769 UTSW Fam124a 0.057 R5397 G1 225 N 14 62606389 S449G A G missense Het probably benign 0.000 09/06/2016
15 429738 UTSW Flnc 1.000 R5397 G1 225 N 6 29441161 M371I G A missense Het possibly damaging 0.866 phenotype 09/06/2016
16 429755 UTSW Gad1-ps 0.119 R5397 G1 225 N 10 99445147 G A exon Het noncoding transcript 0.291 09/06/2016
17 429764 UTSW Gm4787 0.056 R5397 G1 225 N 12 81377830 T518S G C missense Het probably benign 0.008 0.090 09/06/2016
18 429776 UTSW Gm7102 0.159 R5397 G1 225 N 19 61175926 G24R C T missense Het unknown 0.109 09/06/2016
19 429730 UTSW Gpr149 0.071 R5397 G1 225 N 3 62530805 S644P A G missense Het probably damaging 1.000 phenotype 09/06/2016
20 429731 UTSW Gucy1b1 0.363 R5397 G1 225 N 3 82044151 T274I G A missense Het possibly damaging 0.915 phenotype 09/06/2016
21 429721 UTSW Kcnq5 0.372 R5397 G1 225 N 1 21405856 V541A A G missense Het probably damaging 1.000 phenotype 09/06/2016
22 429723 UTSW Kdm5b 0.265 R5397 G1 225 N 1 134622098 G A splice site 5 bp Het probably null 0.976 phenotype 09/06/2016
23 429747 UTSW Lig4 1.000 R5397 G1 225 N 8 9972644 R379S G T missense Het probably benign 0.011 phenotype 09/06/2016
24 429750 UTSW Map7 0.327 R5397 G1 209 N 10 20273321 R514Q G A missense Het unknown phenotype 09/06/2016
25 429728 UTSW Mertk 0.189 R5397 G1 225 N 2 128771464 F467I T A missense Het possibly damaging 0.860 phenotype 09/06/2016
26 429774 UTSW Mettl4 0.362 R5397 G1 225 N 17 94727277 Y463* A T nonsense Het probably null 09/06/2016
27 429766 UTSW Nme8 0.122 R5397 G1 225 N 13 19694379 D70G T C missense Het probably damaging 0.999 phenotype 09/06/2016
28 429749 UTSW Npat 1.000 R5397 G1 225 N 9 53570474 N1161D A G missense Het probably damaging 0.998 09/06/2016
29 429727 UTSW Olfr1283 0.552 R5397 G1 225 N 2 111368940 C103S T A missense Het probably benign 0.001 phenotype 09/06/2016
30 429745 UTSW Olfr616 0.079 R5397 G1 225 N 7 103564506 I258F T A missense Het probably damaging 0.994 phenotype 09/06/2016
31 429756 UTSW Olfr813 0.127 R5397 G1 225 N 10 129856710 F64S T C missense Het probably damaging 1.000 phenotype 09/06/2016
32 478333 UTSW Paxip1 1.000 R5397 G1 225 N 5 27772004 A T unclassified Het probably benign phenotype 06/23/2017
33 429737 UTSW Peg10 1.000 R5397 G1 217 N 6 4756453 C CTCG small insertion Het probably benign phenotype 09/06/2016
34 429754 UTSW Plxnc1 0.372 R5397 G1 225 N 10 94843752 T923A T C missense Het probably benign 0.077 phenotype 09/06/2016
35 429722 UTSW Pms1 0.000 R5397 G1 225 N 1 53192120 K857* T A nonsense Het probably null phenotype 09/06/2016
36 429761 UTSW Ppp1r9b 0.000 R5397 G1 202 N 11 95002110 E260G A G missense Het probably damaging 0.997 phenotype 09/06/2016
37 429734 UTSW Prpf3 1.000 R5397 G1 225 N 3 95853579 S4T A T missense Het probably benign 0.087 phenotype 09/06/2016
38 429763 UTSW Rdh14 0.080 R5397 G1 225 N 12 10394869 V240D T A missense Het probably damaging 0.992 09/06/2016
39 429777 UTSW Ripply1 0.000 R5397 G1 116 N X 139779850 TTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCT TTCCTCCTCCTCCTCCTCCTCCTCCTCCT small deletion Het probably benign 0.090 phenotype 09/06/2016
40 429733 UTSW S100a1 R5397 G1 225 N 3 90512135 M1K A T start codon destroyed Het probably null 0.999 phenotype 09/06/2016
41 429736 UTSW Slc2a5 0.070 R5397 G1 225 N 4 150139823 G A splice site 5 bp Het probably null phenotype 09/06/2016
42 478334 UTSW Slc5a5 0.000 R5397 G1 225 N 8 70891179 T160A T C missense Het probably damaging 0.996 phenotype 06/23/2017
43 429746 UTSW Srcap 0.964 R5397 G1 225 N 7 127553296 T G critical splice donor site 2 bp Het probably null phenotype 09/06/2016
44 429765 UTSW Tcrg-V5 0.108 R5397 G1 225 N 13 19192558 E42D A C missense Het possibly damaging 0.845 09/06/2016
45 429729 UTSW Tgm6 0.000 R5397 G1 225 N 2 130141908 M329K T A missense Het possibly damaging 0.899 phenotype 09/06/2016
46 429760 UTSW Tom1l1 0.211 R5397 G1 225 N 11 90661774 A201V G A missense Het probably benign 0.022 09/06/2016
47 429748 UTSW Ttc13 0.000 R5397 G1 225 N 8 124675263 T662A T C missense Het possibly damaging 0.936 09/06/2016
48 429726 UTSW Ttn 1.000 R5397 G1 225 N 2 76725255 T30469A T C missense Het probably damaging 0.993 phenotype 09/06/2016
49 429742 UTSW Ube3a 0.577 R5397 G1 225 N 7 59286912 S645R T A missense Het probably benign 0.264 phenotype 09/06/2016
50 429751 UTSW Vgll2 0.814 R5397 G1 225 N 10 52025166 E64G A G missense Het probably damaging 1.000 phenotype 09/06/2016
51 429739 UTSW Vmn1r25 0.111 R5397 G1 225 N 6 57979075 C76* A T nonsense Het probably null 09/06/2016
52 429773 UTSW Vmn2r101 0.099 R5397 G1 225 N 17 19588842 N78D A G missense Het probably damaging 0.999 09/06/2016
53 429757 UTSW Zcchc10 0.092 R5397 G1 125 N 11 53332517 CCAGCAGCAGCAGCAGCAGCAG CCAGCAGCAGCAGCAGCAG unclassified Het probably benign 09/06/2016
54 429735 UTSW Zcchc7 0.345 R5397 G1 225 N 4 44926048 A28E C A missense Het probably damaging 0.958 09/06/2016
[records 1 to 54 of 54]