Incidental Mutations

54 incidental mutations are currently displayed, and affect 54 genes.
8 are Possibly Damaging.
21 are Probably Damaging.
15 are Probably Benign.
7 are Probably Null.
3 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 54 of 54] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 429768 UTSW Acox2 0.126 R5397 G1 225 N 14 8243803 (GRCm38) T518A T C missense Het probably benign 0.021 phenotype 2016-09-06
2 429772 UTSW Acvr1b 1.000 R5397 G1 225 N 15 101198964 (GRCm38) V254D T A missense Het probably damaging 0.990 phenotype 2016-09-06
3 429732 UTSW Adar 1.000 R5397 G1 225 N 3 89735319 (GRCm38) I169T T C missense Het probably benign 0.000 phenotype 2016-09-06
4 429775 UTSW Afg3l2 1.000 R5397 G1 225 N 18 67421259 (GRCm38) L458M G T missense Het probably damaging 1.000 0.387 phenotype 2016-09-06
5 429744 UTSW Arap1 0.000 R5397 G1 225 N 7 101384912 (GRCm38) Q187L A T missense Het possibly damaging 0.951 phenotype 2016-09-06
6 429759 UTSW Atad5 1.000 R5397 G1 225 N 11 80111493 (GRCm38) M1037K T A missense Het probably damaging 0.999 phenotype 2016-09-06
7 429753 UTSW Bsg 0.920 R5397 G1 225 N 10 79708795 (GRCm38) W56R T A missense Het probably damaging 1.000 phenotype 2016-09-06
8 429770 UTSW C1qtnf3 0.000 R5397 G1 225 N 15 10978541 (GRCm38) T276A A G missense Het probably damaging 0.989 phenotype 2016-09-06
9 429725 UTSW Capn2 1.000 R5397 G1 225 N 1 182470706 (GRCm38) C665R A G missense Het probably damaging 1.000 phenotype 2016-09-06
10 429767 UTSW Cast 0.000 R5397 G1 225 N 13 74720937 (GRCm38) S248P A G missense Het possibly damaging 0.827 phenotype 2016-09-06
11 429758 UTSW Cd68 0.300 R5397 G1 225 N 11 69665658 (GRCm38) V108I C T missense Het probably benign 0.003 phenotype 2016-09-06
12 429771 UTSW Cyp2d11 0.155 R5397 G1 225 N 15 82392078 (GRCm38) W131R A T missense Het probably damaging 1.000 2016-09-06
13 429762 UTSW Dhx58 0.180 R5397 G1 225 N 11 100703920 (GRCm38) V50A A G missense Het probably damaging 0.998 phenotype 2016-09-06
14 429769 UTSW Fam124a 0.063 R5397 G1 225 N 14 62606389 (GRCm38) S449G A G missense Het probably benign 0.000 2016-09-06
15 429738 UTSW Flnc 1.000 R5397 G1 225 N 6 29441161 (GRCm38) M371I G A missense Het possibly damaging 0.866 phenotype 2016-09-06
16 429755 UTSW Gad1-ps 0.186 R5397 G1 225 N 10 99445147 (GRCm38) G A exon Het noncoding transcript 0.291 2016-09-06
17 429764 UTSW Gm4787 0.061 R5397 G1 225 N 12 81377830 (GRCm38) T518S G C missense Het probably benign 0.008 0.090 2016-09-06
18 429776 UTSW Gm7102 0.128 R5397 G1 225 N 19 61175926 (GRCm38) G24R C T missense Het unknown 0.109 2016-09-06
19 429730 UTSW Gpr149 0.083 R5397 G1 225 N 3 62530805 (GRCm38) S644P A G missense Het probably damaging 1.000 phenotype 2016-09-06
20 429731 UTSW Gucy1b1 0.877 R5397 G1 225 N 3 82044151 (GRCm38) T274I G A missense Het possibly damaging 0.915 phenotype 2016-09-06
21 429721 UTSW Kcnq5 0.528 R5397 G1 225 N 1 21405856 (GRCm38) V541A A G missense Het probably damaging 1.000 phenotype 2016-09-06
22 429723 UTSW Kdm5b 0.452 R5397 G1 225 N 1 134622098 (GRCm38) G A splice site 5 bp Het probably null 0.976 phenotype 2016-09-06
23 429747 UTSW Lig4 1.000 R5397 G1 225 N 8 9972644 (GRCm38) R379S G T missense Het probably benign 0.011 phenotype 2016-09-06
24 429750 UTSW Map7 0.468 R5397 G1 209 N 10 20273321 (GRCm38) R514Q G A missense Het unknown phenotype 2016-09-06
25 429728 UTSW Mertk 0.121 R5397 G1 225 N 2 128771464 (GRCm38) F467I T A missense Het possibly damaging 0.860 phenotype 2016-09-06
26 429774 UTSW Mettl4 0.226 R5397 G1 225 N 17 94727277 (GRCm38) Y463* A T nonsense Het probably null 2016-09-06
27 429766 UTSW Nme8 0.128 R5397 G1 225 N 13 19694379 (GRCm38) D70G T C missense Het probably damaging 0.999 phenotype 2016-09-06
28 429749 UTSW Npat 1.000 R5397 G1 225 N 9 53570474 (GRCm38) N1161D A G missense Het probably damaging 0.998 2016-09-06
29 429727 UTSW Olfr1283 0.582 R5397 G1 225 N 2 111368940 (GRCm38) C103S T A missense Het probably benign 0.001 phenotype 2016-09-06
30 429745 UTSW Olfr616 0.118 R5397 G1 225 N 7 103564506 (GRCm38) I258F T A missense Het probably damaging 0.994 phenotype 2016-09-06
31 429756 UTSW Olfr813 0.118 R5397 G1 225 N 10 129856710 (GRCm38) F64S T C missense Het probably damaging 1.000 phenotype 2016-09-06
32 478333 UTSW Paxip1 1.000 R5397 G1 225 N 5 27772004 (GRCm38) A T unclassified Het probably benign phenotype 2017-06-23
33 429737 UTSW Peg10 1.000 R5397 G1 217 N 6 4756453 (GRCm38) C CTCG small insertion Het probably benign phenotype 2016-09-06
34 429754 UTSW Plxnc1 0.252 R5397 G1 225 N 10 94843752 (GRCm38) T923A T C missense Het probably benign 0.077 phenotype 2016-09-06
35 429722 UTSW Pms1 0.000 R5397 G1 225 N 1 53192120 (GRCm38) K857* T A nonsense Het probably null phenotype 2016-09-06
36 429761 UTSW Ppp1r9b 0.000 R5397 G1 202 N 11 95002110 (GRCm38) E260G A G missense Het probably damaging 0.997 phenotype 2016-09-06
37 429734 UTSW Prpf3 1.000 R5397 G1 225 N 3 95853579 (GRCm38) S4T A T missense Het probably benign 0.087 phenotype 2016-09-06
38 429763 UTSW Rdh14 0.076 R5397 G1 225 N 12 10394869 (GRCm38) V240D T A missense Het probably damaging 0.992 2016-09-06
39 429777 UTSW Ripply1 0.000 R5397 G1 116 N X 139779850 (GRCm38) TTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCT TTCCTCCTCCTCCTCCTCCTCCTCCTCCT small deletion Het probably benign 0.090 phenotype 2016-09-06
40 429733 UTSW S100a1 R5397 G1 225 N 3 90512135 (GRCm38) M1K A T start codon destroyed Het probably null 0.999 phenotype 2016-09-06
41 429736 UTSW Slc2a5 0.094 R5397 G1 225 N 4 150139823 (GRCm38) G A splice site 5 bp Het probably null phenotype 2016-09-06
42 478334 UTSW Slc5a5 0.000 R5397 G1 225 N 8 70891179 (GRCm38) T160A T C missense Het probably damaging 0.996 phenotype 2017-06-23
43 429746 UTSW Srcap 0.956 R5397 G1 225 N 7 127553296 (GRCm38) T G critical splice donor site 2 bp Het probably null phenotype 2016-09-06
44 429765 UTSW Tcrg-V5 0.089 R5397 G1 225 N 13 19192558 (GRCm38) E42D A C missense Het possibly damaging 0.845 2016-09-06
45 429729 UTSW Tgm6 0.000 R5397 G1 225 N 2 130141908 (GRCm38) M329K T A missense Het possibly damaging 0.899 phenotype 2016-09-06
46 429760 UTSW Tom1l1 0.196 R5397 G1 225 N 11 90661774 (GRCm38) A201V G A missense Het probably benign 0.022 2016-09-06
47 429748 UTSW Ttc13 0.000 R5397 G1 225 N 8 124675263 (GRCm38) T662A T C missense Het possibly damaging 0.936 2016-09-06
48 429726 UTSW Ttn 1.000 R5397 G1 225 N 2 76725255 (GRCm38) T30469A T C missense Het probably damaging 0.993 phenotype 2016-09-06
49 429742 UTSW Ube3a 0.626 R5397 G1 225 N 7 59286912 (GRCm38) S645R T A missense Het probably benign 0.264 phenotype 2016-09-06
50 429751 UTSW Vgll2 0.748 R5397 G1 225 N 10 52025166 (GRCm38) E64G A G missense Het probably damaging 1.000 phenotype 2016-09-06
51 429739 UTSW Vmn1r25 0.170 R5397 G1 225 N 6 57979075 (GRCm38) C76* A T nonsense Het probably null 2016-09-06
52 429773 UTSW Vmn2r101 0.080 R5397 G1 225 N 17 19588842 (GRCm38) N78D A G missense Het probably damaging 0.999 2016-09-06
53 429757 UTSW Zcchc10 0.087 R5397 G1 125 N 11 53332517 (GRCm38) CCAGCAGCAGCAGCAGCAGCAG CCAGCAGCAGCAGCAGCAG unclassified Het probably benign 2016-09-06
54 429735 UTSW Zcchc7 0.422 R5397 G1 225 N 4 44926048 (GRCm38) A28E C A missense Het probably damaging 0.958 2016-09-06
[records 1 to 54 of 54]