Incidental Mutations

46 incidental mutations are currently displayed, and affect 46 genes.
11 are Possibly Damaging.
13 are Probably Damaging.
14 are Probably Benign.
7 are Probably Null.
0 create premature stop codons.
3 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 46 of 46] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 427804 UTSW Arhgap39 0.261 R5417 G1 225 N 15 76735101 V761A A G missense Het possibly damaging 0.804 09/01/2016
2 427796 UTSW Ccdc47 1.000 R5417 G1 225 N 11 106210350 R162Q C T missense Het probably benign 0.172 0.128 phenotype 09/01/2016
3 427770 UTSW Cfap65 0.622 R5417 G1 225 N 1 74925100 E563G T C missense Het probably damaging 1.000 phenotype 09/01/2016
4 427806 UTSW Clec16a 0.619 R5417 G1 225 N 16 10731679 C872Y G A missense Het probably damaging 0.994 0.138 phenotype 09/01/2016
5 427817 UTSW Col17a1 0.000 R5417 G1 225 N 19 47662390 G732C C A missense Het probably damaging 1.000 phenotype 09/01/2016
6 427782 UTSW Cped1 0.070 R5417 G1 225 N 6 22233580 I812V A G missense Het probably null 0.007 09/01/2016
7 427813 UTSW Dennd1c 0.000 R5417 G1 217 N 17 57066755 CCGCCCCTCGCTGACAGC CC frame shift Het probably null 0.654 phenotype 09/01/2016
8 427807 UTSW Dgkg 0.173 R5417 G1 225 N 16 22588331 M168K A T missense Het possibly damaging 0.499 phenotype 09/01/2016
9 427818 UTSW Dnase1l1 0.109 R5417 G1 222 N X 74277038 C T critical splice donor site 1 bp Het probably null 0.488 phenotype 09/01/2016
10 427774 UTSW Dolpp1 0.940 R5417 G1 225 N 2 30396237 L18P T C missense Het probably damaging 1.000 phenotype 09/01/2016
11 427803 UTSW Eif3e 0.959 R5417 G1 225 N 15 43265521 D234E A T missense Het probably benign 0.001 09/01/2016
12 427808 UTSW Epha6 0.000 R5417 G1 225 N 16 60424835 A334S C A missense Het possibly damaging 0.890 0.110 phenotype 09/01/2016
13 427794 UTSW Fbxw10 0.071 R5417 G1 225 N 11 62877164 R942Q G A missense Het possibly damaging 0.533 phenotype 09/01/2016
14 427799 UTSW Flvcr2 0.758 R5417 G1 225 N 12 85747191 F114V T G missense Het probably damaging 0.974 phenotype 09/01/2016
15 427780 UTSW Gm14443 0.064 R5417 G1 225 N 2 175170003 C217S A T missense Het probably damaging 1.000 09/01/2016
16 427798 UTSW Gphb5 0.000 R5417 G1 225 N 12 75412972 V83E A T missense Het possibly damaging 0.943 phenotype 09/01/2016
17 427773 UTSW Gpsm1 0.000 R5417 G1 225 N 2 26324033 T C critical splice donor site 2 bp Het probably null phenotype 09/01/2016
18 427789 UTSW Grik4 0.086 R5417 G1 225 N 9 42671248 F134S A G missense Het probably benign 0.450 phenotype 09/01/2016
19 427781 UTSW Ibsp 0.114 R5417 G1 225 N 5 104310469 E291K G A missense Het possibly damaging 0.951 phenotype 09/01/2016
20 427809 UTSW Igfals 0.000 R5417 G1 216 N 17 24880316 L127R T G missense Het probably damaging 1.000 phenotype 09/01/2016
21 427788 UTSW Igsf9b 0.873 R5417 G1 217 N 9 27334276 CGGCCCCGGCCCAG CGGCCCCGGCCCAGGCCCCGGCCCAG small insertion Het probably benign 09/01/2016
22 427791 UTSW Iqcf3 0.057 R5417 G1 225 N 9 106554214 D63V T A missense Het probably damaging 0.988 09/01/2016
23 427812 UTSW Klc4 0.493 R5417 G1 225 N 17 46632031 A G critical splice donor site 2 bp Het probably null 09/01/2016
24 427771 UTSW Lgr6 0.000 R5417 G1 225 N 1 134994010 A199T C T missense Het probably damaging 1.000 0.308 phenotype 09/01/2016
25 427805 UTSW Mapk8ip2 0.564 R5417 G1 155 N 15 89457439 D284E C A missense Het probably benign 0.161 phenotype 09/01/2016
26 427787 UTSW Muc5b 0.322 R5417 G1 225 N 7 141858044 T1576S A T missense Het unknown phenotype 09/01/2016
27 427793 UTSW Nlrp3 0.067 R5417 G1 225 N 11 59549063 G489S G A missense Het probably damaging 1.000 phenotype 09/01/2016
28 427775 UTSW Nr5a1 1.000 R5417 G1 202 N 2 38708086 Q233L T A missense Het possibly damaging 0.947 phenotype 09/01/2016
29 427778 UTSW Nusap1 1.000 R5417 G1 225 N 2 119647143 V345I G A missense Het probably damaging 0.978 phenotype 09/01/2016
30 427777 UTSW Olfr1301 0.072 R5417 G1 225 N 2 111754920 T224A A G missense Het possibly damaging 0.502 phenotype 09/01/2016
31 427816 UTSW Olfr1494 0.098 R5417 G1 225 N 19 13749853 H249R A G missense Het probably benign 0.177 phenotype 09/01/2016
32 427786 UTSW Olfr612 0.113 R5417 G1 225 N 7 103538763 V157E A T missense Het possibly damaging 0.940 phenotype 09/01/2016
33 427802 UTSW Oxr1 0.000 R5417 G1 225 N 15 41820371 T378A A G missense Het probably benign 0.001 phenotype 09/01/2016
34 427814 UTSW Pcdhb12 0.057 R5417 G1 225 N 18 37436034 F78L T C missense Het probably benign 0.001 09/01/2016
35 427785 UTSW Pgm2l1 0.232 R5417 G1 225 N 7 100272376 I605L A T missense Het probably benign 0.003 09/01/2016
36 427783 UTSW Pik3c2g 0.140 R5417 G1 225 N 6 139736943 I17V A G missense Het probably benign 0.000 phenotype 09/01/2016
37 427769 UTSW Prss39 0.065 R5417 G1 225 N 1 34500128 S150G A G missense Het probably benign 0.000 09/01/2016
38 427801 UTSW Scara5 0.087 R5417 G1 217 N 14 65759662 CG C frame shift Het probably null 0.667 phenotype 09/01/2016
39 427790 UTSW Scg3 0.000 R5417 G1 225 N 9 75669256 Y279F T A missense Het probably benign 0.019 phenotype 09/01/2016
40 427811 UTSW Skiv2l 1.000 R5417 G1 225 N 17 34846598 V327I C T missense Het probably damaging 0.975 phenotype 09/01/2016
41 427815 UTSW Srfbp1 0.947 R5417 G1 225 N 18 52488625 C253R T C missense Het probably benign 0.000 09/01/2016
42 501042 UTSW Tcirg1 0.705 R5417 G1 225 N 19 3903509 C T splice site Het probably null phenotype 12/01/2017
43 427795 UTSW Trim37 0.000 R5417 G1 225 N 11 87166679 Y313C A G missense Het probably damaging 1.000 phenotype 09/01/2016
44 427779 UTSW Ttll9 0.060 R5417 G1 225 N 2 153002992 M427L A T missense Het probably benign 0.000 09/01/2016
45 427776 UTSW Ttn 1.000 R5417 G1 225 N 2 76811243 L5176Q A T missense Het possibly damaging 0.943 0.092 phenotype 09/01/2016
46 427784 UTSW Tubgcp5 0.964 R5417 G1 225 N 7 55825661 R932G A G missense Het possibly damaging 0.903 09/01/2016
[records 1 to 46 of 46]