Incidental Mutations

34 incidental mutations are currently displayed, and affect 34 genes.
11 are Possibly Damaging.
11 are Probably Damaging.
10 are Probably Benign.
1 are Probably Null.
0 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 34 of 34] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 431815 UTSW Acan 1.000 R5525 G1 225 N 7 79099983 T1501A A G missense Het probably benign 0.000 phenotype 10/05/2016
2 431824 UTSW Acin1 0.945 R5525 G1 225 N 14 54664391 A648V G A missense Het possibly damaging 0.942 phenotype 10/05/2016
3 431795 UTSW Agap1 0.177 R5525 G1 225 N 1 89743773 T401A A G missense Het possibly damaging 0.863 phenotype 10/05/2016
4 501103 UTSW Anapc4 1.000 R5525 G1 225 N 5 52856809 M440R T G missense Het probably damaging 0.996 phenotype 12/01/2017
5 431813 UTSW Ankrd26 0.000 R5525 G1 225 N 6 118527731 M739T A G missense Het probably benign 0.001 phenotype 10/05/2016
6 431822 UTSW Brip1 0.000 R5525 G1 225 N 11 86110447 E721G T C missense Het possibly damaging 0.847 phenotype 10/05/2016
7 431793 UTSW Bzw1 0.000 R5525 G1 225 N 1 58402906 E221G A G missense Het possibly damaging 0.773 10/05/2016
8 431825 UTSW Cenpm R5525 G1 225 N 15 82239291 A C critical splice donor site 2 bp Het probably null phenotype 10/05/2016
9 431832 UTSW Exosc1 0.946 R5525 G1 225 N 19 41924018 K143N T A missense Het probably damaging 1.000 phenotype 10/05/2016
10 431810 UTSW Fgd5 0.236 R5525 G1 225 N 6 92066247 L1236Q T A missense Het probably damaging 1.000 phenotype 10/05/2016
11 431829 UTSW Gemin6 0.819 R5525 G1 225 N 17 80227749 V46G T G missense Het probably damaging 0.978 0.420 10/05/2016
12 431807 UTSW Grm3 0.000 R5525 G1 225 N 5 9504872 V807I C T missense Het probably damaging 0.996 phenotype 10/05/2016
13 431819 UTSW Kndc1 0.000 R5525 G1 225 N 7 139924111 N1110S A G missense Het probably benign 0.001 phenotype 10/05/2016
14 431811 UTSW Magi1 0.232 R5525 G1 225 N 6 93792373 V17D A T missense Het possibly damaging 0.947 phenotype 10/05/2016
15 431803 UTSW Mdn1 1.000 R5525 G1 225 N 4 32767961 M5298R T G missense Het possibly damaging 0.730 10/05/2016
16 431814 UTSW Nlrp9c 0.000 R5525 G1 225 N 7 26384501 E551V T A missense Het probably damaging 0.998 10/05/2016
17 431830 UTSW Oacyl 0.084 R5525 G1 225 N 18 65745356 I457L A C missense Het probably benign 0.001 10/05/2016
18 431828 UTSW Olfr103 0.066 R5525 G1 225 N 17 37336626 G202D C T missense Het probably damaging 0.987 phenotype 10/05/2016
19 431800 UTSW Olfr1102 0.224 R5525 G1 225 N 2 87002339 E123D A T missense Het possibly damaging 0.953 phenotype 10/05/2016
20 431818 UTSW Olfr494 0.128 R5525 G1 225 N 7 108367999 I170V A G missense Het probably benign 0.000 phenotype 10/05/2016
21 431826 UTSW Rab11fip3 0.000 R5525 G1 225 N 17 25991295 E996G T C missense Het probably damaging 1.000 phenotype 10/05/2016
22 431821 UTSW Rabep1 0.414 R5525 G1 225 N 11 70923146 S554T T A missense Het probably damaging 1.000 10/05/2016
23 431831 UTSW Rln1 0.000 R5525 G1 225 N 19 29334520 E26G T C missense Het probably benign 0.439 phenotype 10/05/2016
24 501102 UTSW Rpf1 0.919 R5525 G1 225 N 3 146517804 A G splice site Het silent 12/01/2017
25 431808 UTSW Sdk1 0.080 R5525 G1 225 N 5 142185265 V1961A T C missense Het possibly damaging 0.843 phenotype 10/05/2016
26 431796 UTSW Serpinb8 0.058 R5525 G1 225 N 1 107607293 I365F A T missense Het probably damaging 0.991 phenotype 10/05/2016
27 431820 UTSW Shank2 0.000 R5525 G1 161 N 7 144070109 D277G A G missense Het probably damaging 0.999 phenotype 10/05/2016
28 431799 UTSW Snapc4 1.000 R5525 G1 121 N 2 26369526 ACTGCTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGC small deletion Het probably benign phenotype 10/05/2016
29 431809 UTSW Thsd7a 0.000 R5525 G1 216 N 6 12332007 T1269A T C missense Het possibly damaging 0.522 phenotype 10/05/2016
30 431812 UTSW Ttll3 0.000 R5525 G1 225 N 6 113412978 N776D A G missense Het probably benign 0.000 phenotype 10/05/2016
31 431794 UTSW Unc80 0.914 R5525 G1 225 N 1 66606614 E1483G A G missense Het possibly damaging 0.719 phenotype 10/05/2016
32 431798 UTSW Ush2a 0.652 R5525 G1 225 N 1 188753606 D2971G A G missense Het probably benign 0.010 phenotype 10/05/2016
33 431823 UTSW Zfp322a 0.150 R5525 G1 225 N 13 23357515 V19A A G missense Het probably benign 0.000 phenotype 10/05/2016
34 431806 UTSW Zfp462 0.408 R5525 G1 225 N 4 55050281 P2164T C A missense Het possibly damaging 0.725 phenotype 10/05/2016
[records 1 to 34 of 34]