Incidental Mutations

45 incidental mutations are currently displayed, and affect 45 genes.
5 are Possibly Damaging.
12 are Probably Damaging.
20 are Probably Benign.
8 are Probably Null.
7 create premature stop codons.
0 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 45 of 45] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 437318 UTSW Acap2 0.182 R5578 G1 225 N 16 31108114 S521P A G missense Het probably benign 0.002 10/26/2016
2 437302 UTSW Aqp11 0.000 R5578 G1 225 N 7 97737458 F177S A G missense Het probably damaging 0.999 phenotype 10/26/2016
3 437285 UTSW Arhgap40 0.343 R5578 G1 225 N 2 158531206 G128V G T missense Het probably damaging 0.989 10/26/2016
4 437283 UTSW Aspm 0.000 R5578 G1 225 N 1 139470717 K1011I A T missense Het probably damaging 0.999 phenotype 10/26/2016
5 437295 UTSW Cachd1 0.219 R5578 G1 225 N 4 100865006 T89A A G missense Het probably benign 0.313 10/26/2016
6 437301 UTSW Cep89 0.175 R5578 G1 133 N 7 35409642 ACTCCTCCTCCTCCTCCTCCTCCTC ACTCCTCCTCCTCCTCCTCCTC unclassified Het probably benign 10/26/2016
7 457966 UTSW Cfhr2 0.066 R5578 G1 225 N 1 139831068 C81* A T nonsense Het probably null 02/16/2017
8 437293 UTSW Chd7 0.937 R5578 G1 225 N 4 8847149 T1631A A G missense Het probably benign 0.087 phenotype 10/26/2016
9 437291 UTSW Clca4b 0.069 R5578 G1 225 N 3 144932435 D22V T A missense Het probably benign 0.039 phenotype 10/26/2016
10 437322 UTSW Cybb 0.000 R5578 G1 222 N X 9450750 D246H C G missense Het probably benign 0.098 0.090 phenotype 10/26/2016
11 437319 UTSW Cyp39a1 0.073 R5578 G1 225 N 17 43680140 N113K T A missense Het possibly damaging 0.914 phenotype 10/26/2016
12 437314 UTSW Dnah11 0.693 R5578 G1 225 N 12 118018802 V2544D A T missense Het probably damaging 0.985 phenotype 10/26/2016
13 437308 UTSW Esr1 0.897 R5578 G1 225 N 10 4969164 Q418P A C missense Het probably damaging 0.998 phenotype 10/26/2016
14 437304 UTSW Fam89a 0.058 R5578 G1 225 N 8 124741229 K115* T A nonsense Het probably null 10/26/2016
15 437311 UTSW Fstl4 0.144 R5578 G1 225 N 11 53165781 V455D T A missense Het probably damaging 1.000 phenotype 10/26/2016
16 437284 UTSW Gm10031 R5578 G1 225 N 1 156525230 M334V A G missense Het probably benign 0.000 10/26/2016
17 457967 UTSW Gm20730 0.080 R5578 G1 225 N 6 43081540 M113L T A missense Het probably benign 0.004 02/16/2017
18 437290 UTSW Hist2h2ab 0.409 R5578 G1 225 N 3 96220238 V108A T C missense Het probably damaging 0.997 phenotype 10/26/2016
19 437315 UTSW Hk3 0.074 R5578 G1 225 N 13 55012181 V327M C T missense Het probably damaging 1.000 phenotype 10/26/2016
20 437281 UTSW Itm2c 0.261 R5578 G1 225 N 1 85903053 V57E T A missense Het possibly damaging 0.633 10/26/2016
21 437288 UTSW Lrba 0.000 R5578 G1 225 N 3 86757507 Y565H T C missense Het probably benign 0.274 phenotype 10/26/2016
22 437287 UTSW Mab21l1 0.000 R5578 G1 225 N 3 55784014 Q341* C T nonsense Het probably null phenotype 10/26/2016
23 437310 UTSW Mdm2 1.000 R5578 G1 225 N 10 117702287 E69K C T missense Het possibly damaging 0.813 phenotype 10/26/2016
24 437294 UTSW Mdn1 1.000 R5578 G1 225 N 4 32728167 I2709F A T missense Het probably benign 0.044 10/26/2016
25 437321 UTSW Mpp7 0.133 R5578 G1 225 N 18 7355101 N442D T C missense Het probably benign 0.000 phenotype 10/26/2016
26 437286 UTSW Ncoa3 0.946 R5578 G1 225 N 2 166054328 I384V A G missense Het probably benign 0.004 phenotype 10/26/2016
27 437282 UTSW Pm20d1 0.082 R5578 G1 225 N 1 131816022 N475S A G missense Het probably benign 0.010 10/26/2016
28 501143 UTSW Rhpn2 0.375 R5578 G1 225 N 7 35370710 D131G A G missense Het probably damaging 1.000 phenotype 12/01/2017
29 437305 UTSW S1pr5 0.345 R5578 G1 162 N 9 21244551 Y193F T A missense Het probably damaging 0.999 phenotype 10/26/2016
30 437297 UTSW Sdk1 0.073 R5578 G1 225 N 5 141613125 K182* A T nonsense Het probably null phenotype 10/26/2016
31 437317 UTSW Slx4 1.000 R5578 G1 225 N 16 3986862 E696V T A missense Het probably damaging 0.999 phenotype 10/26/2016
32 437312 UTSW Smyd4 0.000 R5578 G1 225 N 11 75404776 P753S C T missense Het probably benign 0.033 phenotype 10/26/2016
33 437299 UTSW Stambp 0.825 R5578 G1 225 N 6 83561800 D206A T G missense Het probably benign 0.002 phenotype 10/26/2016
34 437303 UTSW Sult5a1 0.065 R5578 G1 225 N 8 123143121 Y262* G T nonsense Het probably null 10/26/2016
35 437309 UTSW Taar1 0.123 R5578 G1 225 N 10 23920820 I139F A T missense Het possibly damaging 0.712 phenotype 10/26/2016
36 437289 UTSW Tchh 0.095 R5578 G1 205 N 3 93444311 R353* A T nonsense Het probably null 10/26/2016
37 437298 UTSW Thnsl2 0.099 R5578 G1 225 N 6 71138765 V153I C T missense Het probably benign 0.399 phenotype 10/26/2016
38 437313 UTSW Trmt5 0.956 R5578 G1 225 N 12 73285063 C T unclassified Het probably null phenotype 10/26/2016
39 437280 UTSW Trpa1 0.114 R5578 G1 225 N 1 14887008 Y728F T A missense Het probably damaging 1.000 phenotype 10/26/2016
40 437306 UTSW Usp19 0.345 R5578 G1 225 N 9 108493440 V126A T C missense Het probably benign 0.000 phenotype 10/26/2016
41 437316 UTSW Vcan 1.000 R5578 G1 225 N 13 89691503 V1974A A G missense Het probably benign 0.008 phenotype 10/26/2016
42 437320 UTSW Vmn2r120 0.089 R5578 G1 225 N 17 57522514 H461L T A missense Het probably benign 0.011 10/26/2016
43 437292 UTSW Wdr63 0.103 R5578 G1 225 N 3 146097228 Y69* A T nonsense Het probably null 10/26/2016
44 437307 UTSW Zfp445 0.531 R5578 G1 225 N 9 122853337 Y513C T C missense Het probably benign 0.002 10/26/2016
45 437300 UTSW Zfp84 0.000 R5578 G1 225 N 7 29775431 M43L A C missense Het possibly damaging 0.930 10/26/2016
[records 1 to 45 of 45]