Incidental Mutations

49 incidental mutations are currently displayed, and affect 49 genes.
4 are Possibly Damaging.
16 are Probably Damaging.
21 are Probably Benign.
7 are Probably Null.
2 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 49 of 49] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 443614 UTSW 1110008F13Rik R5690 G1 225 N 2 156865314 V58I G A missense Het probably benign 0.043 11/09/2016
2 443624 UTSW 2810474O19Rik 0.000 R5690 G1 225 N 6 149328237 L927S T C missense Het possibly damaging 0.946 11/09/2016
3 443635 UTSW 4930533K18Rik 0.257 R5690 G1 213 N 10 70923314 A G utr 3 prime Het probably benign 11/09/2016
4 443608 UTSW Acadl 0.614 R5690 G1 225 N 1 66853286 Y126C T C missense Het probably damaging 1.000 phenotype 11/09/2016
5 443645 UTSW Ak6 0.962 R5690 G1 187 N 13 100655621 A G unclassified 26 bp Het probably null phenotype 11/09/2016
6 501296 UTSW Ap1s1 0.230 R5690 G1 115 N 5 137037379 ATCCTCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTC unclassified Het probably benign phenotype 12/01/2017
7 443616 UTSW Aqp7 0.096 R5690 G1 203 N 4 41035510 T115I G A missense Het probably benign 0.003 0.090 phenotype 11/09/2016
8 443622 UTSW Atp6v1e1 1.000 R5690 G1 225 N 6 120808356 A T splice site 6 bp Het probably null phenotype 11/09/2016
9 501299 UTSW Axin1 1.000 R5690 G1 225 N 17 26194937 Y792C A G missense Het probably damaging 0.999 phenotype 12/01/2017
10 443623 UTSW C1s2 0.197 R5690 G1 225 N 6 124631037 N233S T C missense Het probably benign 0.126 11/09/2016
11 443626 UTSW Ccer2 0.068 R5690 G1 175 N 7 28756204 C A unclassified Het probably benign 11/09/2016
12 458103 UTSW Cfap46 0.000 R5690 G1 225 N 7 139638353 S1481P A G missense Het probably benign 0.006 02/16/2017
13 443633 UTSW Cspg4 0.000 R5690 G1 225 N 9 56898735 T2277S A T missense Het probably benign 0.015 phenotype 11/09/2016
14 443644 UTSW Ctsl 1.000 R5690 G1 225 N 13 64365208 N300I T A missense Het probably damaging 1.000 phenotype 11/09/2016
15 443640 UTSW Dnah2 0.000 R5690 G1 225 N 11 69491544 I1247V T C missense Het probably benign 0.150 phenotype 11/09/2016
16 443653 UTSW Dsg3 0.391 R5690 G1 225 N 18 20522051 Q135L A T missense Het probably benign 0.007 phenotype 11/09/2016
17 443618 UTSW Efcab14 0.000 R5690 G1 225 N 4 115760047 V318M G A missense Het possibly damaging 0.708 11/09/2016
18 443610 UTSW Etl4 0.760 R5690 G1 225 N 2 20805836 S910N G A missense Het probably benign 0.013 phenotype 11/09/2016
19 443650 UTSW Fetub 0.060 R5690 G1 225 N 16 22932331 R143C C T missense Het probably damaging 1.000 0.261 phenotype 11/09/2016
20 501297 UTSW Frmd4b 0.000 R5690 G1 225 N 6 97353203 E133G T C missense Het possibly damaging 0.558 phenotype 12/01/2017
21 443628 UTSW Herc2 0.913 R5690 G1 225 N 7 56157705 F2514S T C missense Het probably benign 0.000 phenotype 11/09/2016
22 443606 UTSW Il18rap 0.000 R5690 G1 225 N 1 40537112 D261G A G missense Het possibly damaging 0.732 phenotype 11/09/2016
23 443627 UTSW Klk1b16 0.086 R5690 G1 225 N 7 44140894 A G critical splice acceptor site Het probably null phenotype 11/09/2016
24 443611 UTSW Lrp1b 0.000 R5690 G1 225 N 2 40750894 A C splice site 6 bp Het probably null phenotype 11/09/2016
25 443641 UTSW Mrpl45 0.954 R5690 G1 225 N 11 97321586 C A intron Het probably benign phenotype 11/09/2016
26 443639 UTSW Myh13 0.116 R5690 G1 225 N 11 67329275 E150G A G missense Het probably damaging 0.996 11/09/2016
27 443643 UTSW Nbas 1.000 R5690 G1 225 N 12 13336284 V737D T A missense Het probably damaging 0.998 phenotype 11/09/2016
28 443625 UTSW Ncr1 0.055 R5690 G1 225 N 7 4338297 Y59H T C missense Het probably damaging 1.000 phenotype 11/09/2016
29 443619 UTSW Nt5c1a 0.093 R5690 G1 225 N 4 123215939 V277E T A missense Het probably damaging 1.000 phenotype 11/09/2016
30 443630 UTSW Ogfod1 0.000 R5690 G1 225 N 8 94058141 S343T T A missense Het probably damaging 0.991 phenotype 11/09/2016
31 443637 UTSW Otogl 0.000 R5690 G1 225 N 10 107777117 G A synonymous Het silent 0.087 phenotype 11/09/2016
32 443654 UTSW Pcdhb18 0.122 R5690 G1 225 N 18 37490484 R289Q G A missense Het probably benign 0.053 0.091 11/09/2016
33 443652 UTSW Pnpla1 0.101 R5690 G1 225 N 17 28878372 I171F A T missense Het probably damaging 0.995 phenotype 11/09/2016
34 443632 UTSW Rdh8 0.000 R5690 G1 225 N 9 20825489 N259S A G missense Het probably damaging 1.000 phenotype 11/09/2016
35 443655 UTSW Slc22a12 0.000 R5690 G1 225 N 19 6536848 M496T A G missense Het probably benign 0.001 phenotype 11/09/2016
36 443620 UTSW Slc8b1 0.000 R5690 G1 225 N 5 120513205 W10* G A nonsense Het probably null phenotype 11/09/2016
37 443638 UTSW Smarcc2 0.807 R5690 G1 225 N 10 128484407 G887S G A missense Het probably damaging 1.000 phenotype 11/09/2016
38 443648 UTSW Smc1b 0.697 R5690 G1 225 N 15 85112773 S549P A G missense Het probably damaging 0.997 phenotype 11/09/2016
39 443651 UTSW Synj2 0.174 R5690 G1 225 N 17 6035527 M1181V A G missense Het probably benign 0.003 phenotype 11/09/2016
40 443615 UTSW Tbx15 0.906 R5690 G1 225 N 3 99308850 S76P T C missense Het probably damaging 0.994 phenotype 11/09/2016
41 501298 UTSW Tbx2 1.000 R5690 G1 225 N 11 85837053 I271F A T missense Het probably damaging 1.000 phenotype 12/01/2017
42 443609 UTSW Thap4 0.251 R5690 G1 225 N 1 93716630 A G critical splice donor site 2 bp Het probably null 11/09/2016
43 443612 UTSW Tmc2 0.239 R5690 G1 225 N 2 130232386 Y333C A G missense Het probably damaging 1.000 phenotype 11/09/2016
44 443634 UTSW Trcg1 0.067 R5690 G1 225 N 9 57241811 P222L C T missense Het probably benign 0.361 11/09/2016
45 443631 UTSW Tubb3 1.000 R5690 G1 225 N 8 123421306 V326A T C missense Het probably benign 0.136 phenotype 11/09/2016
46 443607 UTSW Unc80 0.904 R5690 G1 225 N 1 66640572 I2101L A C missense Het probably benign 0.083 phenotype 11/09/2016
47 443621 UTSW Vmn1r19 0.110 R5690 G1 225 N 6 57404795 L111S T C missense Het probably benign 0.105 11/09/2016
48 443613 UTSW Vps16 0.965 R5690 G1 225 N 2 130439091 Q226* C T nonsense Het probably null 0.976 phenotype 11/09/2016
49 443646 UTSW Xpo4 0.669 R5690 G1 225 N 14 57590989 I805V T C missense Het probably benign 0.026 phenotype 11/09/2016
[records 1 to 49 of 49]