Incidental Mutations

63 incidental mutations are currently displayed, and affect 63 genes.
6 are Possibly Damaging.
20 are Probably Damaging.
28 are Probably Benign.
9 are Probably Null.
4 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 63 of 63] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 447453 UTSW Abca1 1.000 R5810 G1 225 Y 4 53079631 F866L A G missense Het probably benign 0.000 0.060 phenotype 12/15/2016
2 447468 UTSW Abca16 0.000 R5810 G1 225 Y 7 120435932 C314S T A missense Het probably damaging 1.000 0.647 12/15/2016
3 447474 UTSW Actl11 0.060 R5810 G1 225 Y 9 107929221 P248S C T missense Het probably benign 0.234 0.090 12/15/2016
4 501530 UTSW Actr3 1.000 R5810 G1 225 Y 1 125416379 A G intron Het probably benign phenotype 12/01/2017
5 501532 UTSW Baz1a 0.000 R5810 G1 225 Y 12 54927715 G A intron Het probably benign 0.090 phenotype 12/01/2017
6 447494 UTSW Birc6 1.000 R5810 G1 209 Y 17 74670374 N4388T A C missense Het probably damaging 0.999 0.183 phenotype 12/15/2016
7 447445 UTSW Bpifa5 0.049 R5810 G1 225 Y 2 154163718 G A splice site 5 bp Het probably null 0.976 12/15/2016
8 447449 UTSW Car13 0.000 R5810 G1 101 Y 3 14641768 A C splice site Het probably null 0.976 phenotype 12/15/2016
9 447467 UTSW Ceacam18 0.052 R5810 G1 225 Y 7 43636958 H85L A T missense Het probably benign 0.001 0.090 12/15/2016
10 447437 UTSW Cnnm3 0.165 R5810 G1 225 Y 1 36525199 E704G A G missense Het probably benign 0.023 0.069 12/15/2016
11 447493 UTSW Cyp4f14 0.000 R5810 G1 225 Y 17 32906098 I450F T A missense Het possibly damaging 0.884 0.155 phenotype 12/15/2016
12 447483 UTSW Ddhd1 0.000 R5810 G1 225 Y 14 45602707 T710N G T missense Het probably damaging 1.000 0.140 phenotype 12/15/2016
13 447471 UTSW Ddx60 0.113 R5810 G1 225 Y 8 62012388 Q1360* C T nonsense Het probably null 0.976 phenotype 12/15/2016
14 447482 UTSW Dlg5 1.000 R5810 G1 225 Y 14 24146254 V1625A A G missense Het probably damaging 0.991 0.541 phenotype 12/15/2016
15 447436 UTSW Dst 0.267 R5810 G1 225 Y 1 34183040 G A intron Het probably benign phenotype 12/15/2016
16 447476 UTSW Dyrk2 0.467 R5810 G1 225 Y 10 118860340 H338N G T missense Het probably benign 0.160 0.437 phenotype 12/15/2016
17 447447 UTSW Epb41l1 0.000 R5810 G1 225 Y 2 156499655 I187F A T missense Het probably damaging 1.000 0.407 phenotype 12/15/2016
18 447484 UTSW Esd 0.209 R5810 G1 225 Y 14 74745611 D221G A G missense Het probably damaging 1.000 0.957 12/15/2016
19 447469 UTSW Fam53b 0.000 R5810 G1 225 Y 7 132760164 N45I T A missense Het probably damaging 1.000 0.151 12/15/2016
20 447495 UTSW Fchsd1 0.133 R5810 G1 225 Y 18 37959873 C T unclassified Het probably benign 0.090 12/15/2016
21 447456 UTSW Fryl 0.868 R5810 G1 225 Y 5 73090755 D1006E A T missense Het probably benign 0.062 0.091 phenotype 12/15/2016
22 447479 UTSW Gli3 1.000 R5810 G1 225 Y 13 15644309 V232A T C missense Het probably damaging 0.986 0.085 phenotype 12/15/2016
23 501531 UTSW Gm12666 0.184 R5810 G1 225 Y 4 92191583 A T critical splice donor site 2 bp Het probably null 0.950 12/01/2017
24 447461 UTSW Gm28308 0.394 R5810 G1 225 Y 6 52213216 C A unclassified Het probably benign 0.090 12/15/2016
25 447466 UTSW Gpatch1 1.000 R5810 G1 225 Y 7 35295371 A490V G A missense Het probably benign 0.012 0.079 12/15/2016
26 447462 UTSW Hoxa7 0.000 R5810 G1 225 Y 6 52216024 D128G T C missense Het probably benign 0.018 0.130 phenotype 12/15/2016
27 447473 UTSW Igdcc4 0.305 R5810 G1 225 Y 9 65128695 T751A A G missense Het probably damaging 0.999 0.671 12/15/2016
28 447450 UTSW Igsf10 0.230 R5810 G1 225 Y 3 59319071 L2394F G A missense Het probably damaging 1.000 0.647 12/15/2016
29 447441 UTSW Il15ra 0.052 R5810 G1 225 Y 2 11733252 A G splice site 3 bp Het probably null 0.976 phenotype 12/15/2016
30 447463 UTSW Il17re 0.000 R5810 G1 225 Y 6 113469596 A436V C T missense Het probably damaging 0.999 0.414 phenotype 12/15/2016
31 447490 UTSW Krtap19-2 0.067 R5810 G1 225 Y 16 88874236 T C unclassified Het probably benign 0.113 12/15/2016
32 447496 UTSW Lgals12 0.000 R5810 G1 225 Y 19 7606720 D4G T C missense Het probably benign 0.001 0.090 phenotype 12/15/2016
33 447489 UTSW Liph 0.000 R5810 G1 225 Y 16 21968110 L252Q A T missense Het probably damaging 1.000 0.969 phenotype 12/15/2016
34 447470 UTSW Mtg1 1.000 R5810 G1 225 Y 7 140145985 T A splice site Het probably null 0.976 12/15/2016
35 447457 UTSW Myo18b 1.000 R5810 G1 225 Y 5 112834450 L1139P A G missense Het probably damaging 1.000 0.597 phenotype 12/15/2016
36 447444 UTSW Ninl 0.000 R5810 G1 225 Y 2 150950168 R812G T C missense Het probably benign 0.312 0.090 phenotype 12/15/2016
37 447499 UTSW Npm3 0.000 R5810 G1 225 Y 19 45748205 I165T A G missense Het possibly damaging 0.740 0.069 phenotype 12/15/2016
38 447478 UTSW Olfr381 0.076 R5810 G1 225 Y 11 73486095 S243* G T nonsense Het probably null 0.976 phenotype 12/15/2016
39 447454 UTSW Osbpl9 0.000 R5810 G1 225 Y 4 109086374 V231A A G missense Het probably benign 0.001 0.084 phenotype 12/15/2016
40 447477 UTSW Pgam2 0.484 R5810 G1 225 Y 11 5803417 H91R T C missense Het possibly damaging 0.771 0.970 phenotype 12/15/2016
41 447435 UTSW Pkhd1 0.096 R5810 G1 225 Y 1 20200673 W3219R A G missense Het probably benign 0.257 0.090 phenotype 12/15/2016
42 447446 UTSW Procr 0.093 R5810 G1 225 Y 2 155751407 K4E A G missense Het possibly damaging 0.707 0.179 phenotype 12/15/2016
43 447475 UTSW Slc22a16 0.106 R5810 G1 225 Y 10 40595318 T495I C T missense Het possibly damaging 0.861 0.179 phenotype 12/15/2016
44 447497 UTSW Slc22a6 0.054 R5810 G1 225 Y 19 8623858 K425E A G missense Het probably damaging 0.999 0.134 phenotype 12/15/2016
45 447440 UTSW Slco6c1 0.000 R5810 G1 225 Y 1 97075873 C500S A T missense Het probably damaging 1.000 0.896 12/15/2016
46 447465 UTSW Snrpd2 0.960 R5810 G1 225 Y 7 19152522 V77F G T missense Het probably benign 0.025 0.090 phenotype 12/15/2016
47 447439 UTSW Sp100 0.264 R5810 G1 225 Y 1 85665285 G145D G A missense Het probably benign 0.119 0.095 12/15/2016
48 447472 UTSW Spg7 0.145 R5810 G1 225 Y 8 123094569 E678K G A missense Het possibly damaging 0.945 0.198 phenotype 12/15/2016
49 447458 UTSW Ssh1 0.000 R5810 G1 225 Y 5 113946566 K538E T C missense Het probably benign 0.049 0.090 phenotype 12/15/2016
50 447460 UTSW Sspo 0.000 R5810 G1 225 Y 6 48483898 R3356W C T missense Het probably benign 0.018 0.090 12/15/2016
51 447459 UTSW Stx1a 0.000 R5810 G1 225 Y 5 135049078 V255F G T missense Het probably damaging 0.994 0.293 phenotype 12/15/2016
52 447442 UTSW Tbc1d13 0.165 R5810 G1 225 Y 2 30142368 Q164K C A missense Het probably benign 0.020 0.087 12/15/2016
53 447443 UTSW Tfpi 1.000 R5810 G1 182 Y 2 84434424 AATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGA AATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGA intron Het probably benign phenotype 12/15/2016
54 447452 UTSW Tpm2 0.576 R5810 G1 225 Y 4 43518968 T C unclassified Het probably benign phenotype 12/15/2016
55 447486 UTSW Triobp 1.000 R5810 G1 225 Y 15 78968267 C874R T C missense Het probably benign 0.071 0.090 phenotype 12/15/2016
56 447487 UTSW Tymp 0.000 R5810 G1 225 Y 15 89374331 H269L T A missense Het probably damaging 0.990 0.561 phenotype 12/15/2016
57 447480 UTSW Vmn1r194 0.055 R5810 G1 225 Y 13 22244427 Y71* T A nonsense Het probably null 0.976 12/15/2016
58 447491 UTSW Vmn2r102 0.000 R5810 G1 225 Y 17 19677542 V273A T C missense Het probably benign 0.202 0.090 12/15/2016
59 447451 UTSW Vmn2r2 0.107 R5810 G1 225 Y 3 64117394 C589S A T missense Het probably damaging 1.000 0.647 12/15/2016
60 447498 UTSW Vps13a 0.000 R5810 G1 225 Y 19 16666324 T2063A T C missense Het probably benign 0.001 0.090 phenotype 12/15/2016
61 447485 UTSW Ywhaz 0.658 R5810 G1 225 Y 15 36775266 I217M T C missense Het probably damaging 1.000 0.849 phenotype 12/15/2016
62 447481 UTSW Zfp322a 0.106 R5810 G1 225 Y 13 23357409 Y54* A C nonsense Het probably null 0.976 phenotype 12/15/2016
63 447464 UTSW Zswim9 0.062 R5810 G1 225 Y 7 13260735 V498D A T missense Het probably damaging 0.980 0.647 12/15/2016
[records 1 to 63 of 63]